LXL04_025781 | RubberDandelionOmics

Gene overview

LXL04_025781

Reference: OH-1004 Chr: Chr05 Coordinates: 116844022-116845281 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1260 bp · LXL04_025781|LXL04_025781|OH1004|cDNA

ATGGCTCTGAACTATTCTCAGCGGCCGATTTTCCCTGCTTATACATCCGAAGACAATTTGATTTCACCATTACGTATTGTGAATGGGTACGTCGTGGAAGGCATGTCAGAGAATCGTGGAGAAGGCTTCGTCAAGCCTAAACACGGTAACGGAGAAATCCATGATCGTTTTACTTCCGATAAGTGCAACTCACCAGATCCTGTCTCCACCGACATTATCGACTTACTCCCTTCAGATCCATTCGGAATGGACATCGATAT...

CDS

Download CDS FASTA

1260 bp · LXL04_025781|LXL04_025781|OH1004|CDS

ATGGCTCTGAACTATTCTCAGCGGCCGATTTTCCCTGCTTATACATCCGAAGACAATTTGATTTCACCATTACGTATTGTGAATGGGTACGTCGTGGAAGGCATGTCAGAGAATCGTGGAGAAGGCTTCGTCAAGCCTAAACACGGTAACGGAGAAATCCATGATCGTTTTACTTCCGATAAGTGCAACTCACCAGATCCTGTCTCCACCGACATTATCGACTTACTCCCTTCAGATCCATTCGGAATGGACATCGATAT...

Protein

Download Protein FASTA

419 aa · LXL04_025781|LXL04_025781|OH1004|PROTEIN

MALNYSQRPIFPAYTSEDNLISPLRIVNGYVVEGMSENRGEGFVKPKHGNGEIHDRFTSDKCNSPDPVSTDIIDLLPSDPFGMDIDINTFNAITTGWLEDLEEDYVWNNIANNQLNLFWNNALRFQSFPINNKHRAPYMVDHHHDNNITTSVTTRDPHEAFLLSLSYLPTKDLLLLESVCRTLHSTIRNDPLLWRTIHIDQPLSEKITDDILVQLTTRSEGNLRCLTLIKCPRITDDGLKRVLETNPKLTKLSVPGCTRL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025781`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025781

Location Chr05:116844022-116845281 (-)

Description Similar to SKIP14: F-box protein SKIP14

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g26000`	Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At3g27290`	F-box protein At3g27290.	No verified direct reference in this release
`At2g01620`	Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025781 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005813 centrosome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0019005 SCF ubiquitin ligase complex Cellular Component

KEGG gene cross-reference

ath:AT2G01620

ath:AT3G26000

ath:AT3G27290

dre:569430

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.441

Rank 1 · LXL04_025781 · OH-1004

Cytoplasm0.386

Rank 2 · LXL04_025781 · OH-1004

Mitochondrion0.096

Rank 3 · LXL04_025781 · OH-1004

Cell membrane0.064

Rank 4 · LXL04_025781 · OH-1004

Lysosome / Vacuole0.047

Rank 5 · LXL04_025781 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12937.13F-box-like157-199 aa

PF28114.1At3g27290_F_box_C339-409 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025781	`PF12937.13`	F-box-like	157	199	3.1e-07	30.8
LXL04_025781	`PF28114.1`	At3g27290_F_box_C	339	409	5.9e-26	91.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LU91`	Arabidopsis thaliana	F-box protein SKIP14	47.843%	Swiss-Prot	moderate database homology
`Q9LK24`	Arabidopsis thaliana	F-box protein At3g27290	36.202%	Swiss-Prot	moderate database homology
`Q9ZU90`	Arabidopsis thaliana	F-box protein SKIP28	32.184%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card