LXL04_025771 | RubberDandelionOmics

Gene overview

LXL04_025771

Reference: OH-1004 Chr: Chr05 Coordinates: 116789976-116791611 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

738 bp · LXL04_025771|LXL04_025771|OH1004|cDNA

ATGGCGAGCATCAGCACCTCCTTGGAAGATGTACCTTCTACCGACATCATGACTGAACTCCTCCGCCGACTCAAGTGCTCATCCAAGCCCGATAAGCGCCTCATCCTCATTGGTCCACCCGGATCTGGAAAAGGTACCCAATCGCCCATCATCAAGGACGAATTCTGCCTATGCCACCTGGCAACCGGTGATATGTTGAGAGCAGCCGTCGCTGCTAAAACCCCACTCGGTATCAAAGCCAAAGAAACCATGGAGAAGGG...

CDS

Download CDS FASTA

738 bp · LXL04_025771|LXL04_025771|OH1004|CDS

ATGGCGAGCATCAGCACCTCCTTGGAAGATGTACCTTCTACCGACATCATGACTGAACTCCTCCGCCGACTCAAGTGCTCATCCAAGCCCGATAAGCGCCTCATCCTCATTGGTCCACCCGGATCTGGAAAAGGTACCCAATCGCCCATCATCAAGGACGAATTCTGCCTATGCCACCTGGCAACCGGTGATATGTTGAGAGCAGCCGTCGCTGCTAAAACCCCACTCGGTATCAAAGCCAAAGAAACCATGGAGAAGGG...

Protein

Download Protein FASTA

245 aa · LXL04_025771|LXL04_025771|OH1004|PROTEIN

MASISTSLEDVPSTDIMTELLRRLKCSSKPDKRLILIGPPGSGKGTQSPIIKDEFCLCHLATGDMLRAAVAAKTPLGIKAKETMEKGELVSDDLVVGIIDEAMKKPSCQKGFILDGFPRTVAQAEKLDEMLQKQGTKIDKVLDFAINDSILEERITGRWIHASSGRTYHTKFAPPKTPGVDDVTGEPLMQRKDDTAQVLKSRLEAFHRQTEPVIEYYNKKGVVAKLPAEKPPKEVTVEVQKVLST

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025771`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025771

Location Chr05:116789976-116791611 (+)

Description Similar to ADK-B: Adenylate kinase 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g63400`	Catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP.	No verified direct reference in this release
`At5g50370`	Catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q08480`	Catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP.	No verified direct reference in this release
`Os12g0236400`	Catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025771 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006163 purine nucleotide metabolic process Biological Process

GO:0006172 ADP biosynthetic process Biological Process

GO:0046033 AMP metabolic process Biological Process

GO:0046034 ATP metabolic process Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005758 mitochondrial intermembrane space Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009536 plastid Cellular Component

GO:0004017 AMP kinase activity Molecular Function

GO:0005507 copper ion binding Molecular Function

KEGG gene cross-reference

ath:AT5G50370

ath:AT5G63400

dmo:Dmoj_GI20701

dosa:Os11g0312400

dosa:Os12g0236400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.583

Rank 1 · LXL04_025771 · OH-1004

Cytoplasm0.331

Rank 2 · LXL04_025771 · OH-1004

Nucleus0.125

Rank 3 · LXL04_025771 · OH-1004

Plastid0.088

Rank 4 · LXL04_025771 · OH-1004

Peroxisome0.068

Rank 5 · LXL04_025771 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00406.30ADK36-221 aa

PF13207.13AAA_1737-157 aa

PF05191.21ADK_lid158-193 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025771	`PF00406.30`	ADK	36	221	7.4e-60	202.2
LXL04_025771	`PF13207.13`	AAA_17	37	157	1.2e-24	87.9
LXL04_025771	`PF05191.21`	ADK_lid	158	193	1.4e-16	60.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82514`	Arabidopsis thaliana	Adenylate kinase 4	79.583%	Swiss-Prot	strong database homology
`Q9FK35`	Arabidopsis thaliana	Adenylate kinase 3	75.820%	Swiss-Prot	strong database homology
`Q08480`	Oryza sativa subsp. japonica	Adenylate kinase 4	86.667%	Swiss-Prot	strong database homology
`Q08479`	Oryza sativa subsp. japonica	Adenylate kinase 3	85.892%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card