RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_025715
Reference: OH-1004 Chr: Chr05 Coordinates: 115704828-115707772 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2142 bp · LXL04_025715|LXL04_025715|OH1004|cDNA

ATGGCGCAAGATAGCGACCTTCCTTGCGACGGAGATGGCCGCTGCATGGTCTGCAAAATCAACCCACCGGAAGAAGAGAACATTACTTGCAAAACCTGCGTCACTCCCTGGCATCTTGACTGTCTCTCTGCTCGCCCTCAAACCCTAGCCGATGCCGCGCAATGGGAGTGTCCTGACTGTTCAAATCTCATTACTTCTCCGCCTCCTTCAACCGCCGCATCGGGATCTGAACCGTCCGCTGCGCTTGTTGCGGCCATTCG...

CDS

Download CDS FASTA

2142 bp · LXL04_025715|LXL04_025715|OH1004|CDS

ATGGCGCAAGATAGCGACCTTCCTTGCGACGGAGATGGCCGCTGCATGGTCTGCAAAATCAACCCACCGGAAGAAGAGAACATTACTTGCAAAACCTGCGTCACTCCCTGGCATCTTGACTGTCTCTCTGCTCGCCCTCAAACCCTAGCCGATGCCGCGCAATGGGAGTGTCCTGACTGTTCAAATCTCATTACTTCTCCGCCTCCTTCAACCGCCGCATCGGGATCTGAACCGTCCGCTGCGCTTGTTGCGGCCATTCG...

Protein

Download Protein FASTA

713 aa · LXL04_025715|LXL04_025715|OH1004|PROTEIN

MAQDSDLPCDGDGRCMVCKINPPEEENITCKTCVTPWHLDCLSARPQTLADAAQWECPDCSNLITSPPPSTAASGSEPSAALVAAIRAIESDVSLSDQEKANRRQQLLSGVGSNDGDKLADDKKEAEDAAGGTDILKILSSSFNCSFCMQLPERPVTTPCGHNFCLKCFEKWVNQGKRTCAVCRTAIPAKMANQPRINASLVIAIRMAKMTKSNAASSGPPKAYISVLNQNKPDKAYTTERAKKTGKANACSGKIFVTVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_025715
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_025715
LocationChr05:115704828-115707772 (+)
DescriptionSimilar to ORTH2: E3 ubiquitin-protein ligase ORTHRUS 2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g57820 E3 ubiquitin-protein ligase.
VIM1, a methylcytosine-binding protein required for centromeric heterochromatinization.2007 · DOI: 10.1101/gad.1512007
ORTH/VIM proteins that regulate DNA methylation are functional ubiquitin E3 ligases.2008 · DOI: 10.1111/j.1365-313x.2008.03631.x
Three SRA-domain methylcytosine-binding proteins cooperate to maintain global CpG methylation and epigenetic silencing in Arabidopsis.2008 · DOI: 10.1371/journal.pgen.1000156
At5g39550 E3 ubiquitin-protein ligase.
ORTH/VIM proteins that regulate DNA methylation are functional ubiquitin E3 ligases.2008 · DOI: 10.1111/j.1365-313x.2008.03631.x
Three SRA-domain methylcytosine-binding proteins cooperate to maintain global CpG methylation and epigenetic silencing in Arabidopsis.2008 · DOI: 10.1371/journal.pgen.1000156
At1g66050 E3 ubiquitin-protein ligase.
ORTH/VIM proteins that regulate DNA methylation are functional ubiquitin E3 ligases.2008 · DOI: 10.1111/j.1365-313x.2008.03631.x
Three SRA-domain methylcytosine-binding proteins cooperate to maintain global CpG methylation and epigenetic silencing in Arabidopsis.2008 · DOI: 10.1371/journal.pgen.1000156
At1g66040 E3 ubiquitin-protein ligase. No verified direct reference in this release
At1g57800 E3 ubiquitin-protein ligase. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_025715 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0006325 chromatin organization Biological Process
GO:0010228 vegetative to reproductive phase transition of meristem Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0031508 pericentric heterochromatin formation Biological Process
GO:0044027 negative regulation of gene expression via chromosomal CpG island methylation Biological Process
GO:0051301 cell division Biological Process
GO:0005634 nucleus Cellular Component
GO:0010369 chromocenter Cellular Component
GO:0003682 chromatin binding Molecular Function
GO:0004842 ubiquitin-protein transferase activity Molecular Function
GO:0008270 zinc ion binding Molecular Function
GO:0008327 methyl-CpG binding Molecular Function
KEGG gene cross-reference
ath:AT1G57800
ath:AT1G57820
ath:AT1G66040
ath:AT1G66050
ath:AT5G39550
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.940
Rank 1 · LXL04_025715 · OH-1004
Cytoplasm0.114
Rank 2 · LXL04_025715 · OH-1004
Cell membrane0.039
Rank 3 · LXL04_025715 · OH-1004
Endoplasmic reticulum0.019
Rank 4 · LXL04_025715 · OH-1004
Plastid0.012
Rank 5 · LXL04_025715 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13639.13zf-RING_2144-184 aa
PF13920.13zf-C3HC4_3144-187 aa
PF13445.13zf-RING_UBOX145-180 aa
PF00097.32zf-C3HC4145-183 aa
PF13923.13zf-C3HC4_2145-183 aa
PF15227.13zf-C3HC4_4145-183 aa
PF02182.24SAD_SRA277-425 aa
PF13445.13zf-RING_UBOX518-552 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_025715PF13639.13zf-RING_21441843.5e-0834.3
LXL04_025715PF13920.13zf-C3HC4_31441874e-0833.7
LXL04_025715PF13445.13zf-RING_UBOX1451807e-1349.1
LXL04_025715PF00097.32zf-C3HC41451832.1e-1144.2
LXL04_025715PF13923.13zf-C3HC4_21451831.6e-0834.9
LXL04_025715PF15227.13zf-C3HC4_41451831.3e-0629.2
LXL04_025715PF02182.24SAD_SRA2774252.7e-50170.7
LXL04_025715PF13445.13zf-RING_UBOX5185527e-1349.1
LXL04_025715PF00097.32zf-C3HC45185752.1e-1144.2
LXL04_025715PF13923.13zf-C3HC4_25185451.6e-0834.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8VYZ0Arabidopsis thalianaE3 ubiquitin-protein ligase ORTHRUS 265.902%Swiss-Protstrong database homology
Q9FKA7Arabidopsis thalianaE3 ubiquitin-protein ligase ORTHRUS 160.423%Swiss-Protstrong database homology
Q680I0Arabidopsis thalianaE3 ubiquitin-protein ligase ORTHRUS 561.221%Swiss-Protstrong database homology
Q9C8E1Arabidopsis thalianaPutative E3 ubiquitin-protein ligase ORTHRUS 461.221%Swiss-Protstrong database homology
Q9FVS2Arabidopsis thalianaE3 ubiquitin-protein ligase ORTHRUS 354.711%Swiss-Protstrong database homology

JBrowse

View in Genome Browser