LXL04_025565 | RubberDandelionOmics

Gene overview

LXL04_025565

Reference: OH-1004 Chr: Chr05 Coordinates: 113657739-113665489 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4165 bp · LXL04_025565|LXL04_025565|OH1004|cDNA

atgaagaagaagaagaacaattTTCAATAAGGGAATTAAAGAAACGGCTGAAAGAAACCTTAAGTAAGAGCCCCACACCAGTAAAGATAAAGATAAAAAATGAGGAAAAGATTGATGAAAAAGAAGATGGAGGGGATGACAAGAAGGCTAAGAGTTTAAATGATGCAAGGAGTATGAGGCAGCTGAAGAAGCAGCTGAAAAAAGCCTTATCGGGACAATTGGGAGTCAACCAGAGATGGTTGGCAATATTGATGGTAACG...

CDS

Download CDS FASTA

3930 bp · LXL04_025565|LXL04_025565|OH1004|CDS

ATGGTTGGCAATATTGATGGTAACGGCGGCGAGGGTTCTACCTCAATACCTCGACCATCGCCGTTATCTCCACAGCCATCTTCCATACAACCAACCCATGATCCCCTGCCTGGGCATTTCGCTACCGGCGGTGAGATTTCTACTTCCCATCCACCCTCAAAACCTCCACTATCGCCGTTACATCCGCAATCATCGTCAATCTCAGCTAGCCATGATTCCCCGTCTGTGCATTTAGGCACCGGCGGAGAGGATTCTTCTTC...

Protein

Download Protein FASTA

1309 aa · LXL04_025565|LXL04_025565|OH1004|PROTEIN

MVGNIDGNGGEGSTSIPRPSPLSPQPSSIQPTHDPLPGHFATGGEISTSHPPSKPPLSPLHPQSSSISASHDSPSVHLGTGGEDSSSHPPSQPPLSPIAPELSSITANNDTPPVHFGTDGKGFTSHSPSKPPQSLLPQPPSSITANHDTPAVHFGQISRRRSPRLLDCNNGGTDSSFDINRMPKKKKPRITESSSSSFPSSVSFLIGDPVPDEVARRKWPWRYDCQEPKSNGPFPKTNNNDDDEDKLVLNVKCHYLQAKI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025565`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025565

Location Chr05:113657739-113665489 (-)

Description Similar to CMT2: DNA (cytosine-5)-methyltransferase CMT2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g19020`	May be involved in the CpXpG methylation and in gene silencing.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q5KQL9`	Involved in CpXpG DNA methylation.	No verified direct reference in this release
`Os03g0226800`	Involved in CpXpG DNA methylation (By similarity).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025565 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0032259 methylation Biological Process

GO:0034605 cellular response to heat Biological Process

GO:0044027 negative regulation of gene expression via chromosomal CpG island methylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003682 chromatin binding Molecular Function

GO:0003886 DNA (cytosine-5-)-methyltransferase activity Molecular Function

GO:0032183 SUMO binding Molecular Function

KEGG gene cross-reference

ath:AT4G19020

dosa:Os03g0226800

dosa:Os05g0224800

dosa:Os05g0224900

osa:4338140

zma:542060

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.308

Rank 1 · LXL04_025565 · OH-1004

Nucleus0.299

Rank 2 · LXL04_025565 · OH-1004

Cytoplasm0.220

Rank 3 · LXL04_025565 · OH-1004

Endoplasmic reticulum0.122

Rank 4 · LXL04_025565 · OH-1004

Plastid0.061

Rank 5 · LXL04_025565 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01426.25BAH266-375 aa

PF00385.31Chromo527-582 aa

PF00145.24DNA_methylase591-949 aa

PF13855.13LRR_81047-1104 aa

PF13855.13LRR_81166-1223 aa

PF23598.2LRR_141170-1238 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025565	`PF01426.25`	BAH	266	375	3.4e-13	50.3
LXL04_025565	`PF00385.31`	Chromo	527	582	1.7e-13	51.0
LXL04_025565	`PF00145.24`	DNA_methylase	591	949	8.1e-43	147.8
LXL04_025565	`PF13855.13`	LRR_8	1047	1104	3.2e-12	46.7
LXL04_025565	`PF13855.13`	LRR_8	1166	1223	3.2e-12	46.7
LXL04_025565	`PF23598.2`	LRR_14	1170	1238	2.1e-08	34.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94F87`	Arabidopsis thaliana	DNA (cytosine-5)-methyltransferase CMT2	53.836%	Swiss-Prot	moderate database homology
`Q5KQL9`	Oryza sativa subsp. japonica	DNA (cytosine-5)-methyltransferase CMT2	51.798%	Swiss-Prot	moderate database homology
`A0A0P0VUY4`	Oryza sativa subsp. japonica	DNA (cytosine-5)-methyltransferase CMT1	46.758%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card