LXL04_025498 | RubberDandelionOmics

Gene overview

LXL04_025498

Reference: OH-1004 Chr: Chr05 Coordinates: 112534703-112535932 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1026 bp · LXL04_025498|LXL04_025498|OH1004|cDNA

ATGGGGTCTCTTCCACAATTATATTCAGACCCGTCTTCAGAAAAACCAGCCGATCTCATTGATCCGATAAAACTGAAAAACCTTTTCAAATCCCAACAGAAATACCTCAATAACTTTTTCGATAAGCTAGATCTTTCGCAAACCCATGTATTCACACAAACGCTTTTAAACTCAACCGGTACGATCTTCATCACCGGTGTCGGCAAATCCGGTTTCGTCTCCAAAAACATTTCCCAAACCCTCGTGTCTCTTGGCATAAA...

CDS

Download CDS FASTA

1026 bp · LXL04_025498|LXL04_025498|OH1004|CDS

ATGGGGTCTCTTCCACAATTATATTCAGACCCGTCTTCAGAAAAACCAGCCGATCTCATTGATCCGATAAAACTGAAAAACCTTTTCAAATCCCAACAGAAATACCTCAATAACTTTTTCGATAAGCTAGATCTTTCGCAAACCCATGTATTCACACAAACGCTTTTAAACTCAACCGGTACGATCTTCATCACCGGTGTCGGCAAATCCGGTTTCGTCTCCAAAAACATTTCCCAAACCCTCGTGTCTCTTGGCATAAA...

Protein

Download Protein FASTA

341 aa · LXL04_025498|LXL04_025498|OH1004|PROTEIN

MGSLPQLYSDPSSEKPADLIDPIKLKNLFKSQQKYLNNFFDKLDLSQTHVFTQTLLNSTGTIFITGVGKSGFVSKNISQTLVSLGIKSQFLSPVDALHGDIGILSNNDVLVMFSKSGNTEELIRLVPCARAKGAFLISVTSVDGNALMGMSDLNVHLPLERELCPFDLAPTTSTAIQMVFGCTVAIAMMDAKNLTKEGYAANHPAGRIGKSLIFKVKDVMKKQDELPVCREGDLIMDQLVELTSKGCGCLLVIDDDYHLI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025498`
TK1151 ID	TkA06G056320
OH-1004 ID	LXL04_025498
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025498

Location Chr05:112534703-112535932 (-)

Description Similar to SETH3: Probable arabinose 5-phosphate isomerase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g54690`	Catalyzes the reversible aldol-ketol isomerization between D-ribulose 5-phosphate (Ru5P) and D-arabinose 5-phosphate (A5P).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025498 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:1901135 carbohydrate derivative metabolic process Biological Process

GO:0009507 chloroplast Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016853 isomerase activity Molecular Function

GO:0019146 arabinose-5-phosphate isomerase activity Molecular Function

GO:0097367 carbohydrate derivative binding Molecular Function

KEGG gene cross-reference

aae:aq_1546

ath:AT3G54690

cmu:TC_0679

cpa:CP_0226

cpj:kpsF

cpn:CPn_0526

cpt:CpB0547

ctr:CT_399

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.670

Rank 1 · LXL04_025498 · OH-1004

Nucleus0.322

Rank 2 · LXL04_025498 · OH-1004

Mitochondrion0.119

Rank 3 · LXL04_025498 · OH-1004

Peroxisome0.063

Rank 4 · LXL04_025498 · OH-1004

Cell membrane0.052

Rank 5 · LXL04_025498 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01380.28SIS56-180 aa

PF00571.34CBS216-272 aa

PF00571.34CBS284-339 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025498	`PF01380.28`	SIS	56	180	5.6e-18	65.7
LXL04_025498	`PF00571.34`	CBS	216	272	2e-15	57.5
LXL04_025498	`PF00571.34`	CBS	284	339	2e-15	57.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M1T1`	Arabidopsis thaliana	Probable arabinose 5-phosphate isomerase	74.286%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card