LXL04_025292 | RubberDandelionOmics

Gene overview

LXL04_025292

Reference: OH-1004 Chr: Chr05 Coordinates: 109267072-109271600 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1881 bp · LXL04_025292|LXL04_025292|OH1004|cDNA

ATGCGCCAACTAATCGTGCCTGATTGTCCTCTAGGACGCTTTTGCATTGGACAAATAGGGTTTGGTTTTGACCCAATCACTAATGATCACAAGATTGTGTGTGTACAATATGAAACTAGAGAAAATGCATGTGTTTACTCCATGAAGATGGGATCTTGGCGTCCTATTGCTTCCCCTTTTCCTATTACTTCGTATTGTGAAGTGTTATCAAGCGCGTGCTACGTCAACGGGGTATTGCATTGGGTAGTGGAATGTTTTAT...

CDS

Download CDS FASTA

1881 bp · LXL04_025292|LXL04_025292|OH1004|CDS

ATGCGCCAACTAATCGTGCCTGATTGTCCTCTAGGACGCTTTTGCATTGGACAAATAGGGTTTGGTTTTGACCCAATCACTAATGATCACAAGATTGTGTGTGTACAATATGAAACTAGAGAAAATGCATGTGTTTACTCCATGAAGATGGGATCTTGGCGTCCTATTGCTTCCCCTTTTCCTATTACTTCGTATTGTGAAGTGTTATCAAGCGCGTGCTACGTCAACGGGGTATTGCATTGGGTAGTGGAATGTTTTAT...

Protein

Download Protein FASTA

626 aa · LXL04_025292|LXL04_025292|OH1004|PROTEIN

MRQLIVPDCPLGRFCIGQIGFGFDPITNDHKIVCVQYETRENACVYSMKMGSWRPIASPFPITSYCEVLSSACYVNGVLHWVVECFIERYYIMTFDLCTHEFGMIDLPELGELTTIQGCLGVISSCIWVRRDGYWSVVFKPQTNEVEEVLNEALELASNGDLLLRTFSEGFQVYNMETGERSRLMAFNDTCLLLDMHMYVESLQLFGMGTACQFVVPLHRFTMSEYLCEELIVEIFTRLPSKSLIRFRSVSKSLRSRIDS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025292`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025292

Location Chr05:109267072-109271600 (+)

Description Similar to At3g06240: F-box/kelch-repeat protein At3g06240

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g06240`	F-box/kelch-repeat protein At3g06240.	No verified direct reference in this release
`At3g16210`	Putative F-box protein At3g16210.	No verified direct reference in this release
`At3g10240`	Putative F-box protein At3g10240.	No verified direct reference in this release
`At1g47790`	Putative F-box protein At1g47790.	No verified direct reference in this release
`At4g38870`	Putative F-box protein At4g38870.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025292 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G47790

ath:AT3G06240

ath:AT3G10240

ath:AT3G16210

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.690

Rank 1 · LXL04_025292 · OH-1004

Nucleus0.366

Rank 2 · LXL04_025292 · OH-1004

Cell membrane0.093

Rank 3 · LXL04_025292 · OH-1004

Endoplasmic reticulum0.069

Rank 4 · LXL04_025292 · OH-1004

Mitochondrion0.041

Rank 5 · LXL04_025292 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07734.19FBA_116-108 aa

PF08268.18FBA_319-120 aa

PF00646.39F-box227-264 aa

PF12937.13F-box-like229-262 aa

PF08268.18FBA_3301-490 aa

PF07734.19FBA_1301-462 aa

PF00646.39F-box584-621 aa

PF12937.13F-box-like586-620 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025292	`PF07734.19`	FBA_1	16	108	4.5e-18	66.0
LXL04_025292	`PF08268.18`	FBA_3	19	120	1.1e-32	114.1
LXL04_025292	`PF00646.39`	F-box	227	264	7.9e-18	64.3
LXL04_025292	`PF12937.13`	F-box-like	229	262	2.8e-11	43.7
LXL04_025292	`PF08268.18`	FBA_3	301	490	1.1e-32	114.1
LXL04_025292	`PF07734.19`	FBA_1	301	462	4.5e-18	66.0
LXL04_025292	`PF00646.39`	F-box	584	621	7.9e-18	64.3
LXL04_025292	`PF12937.13`	F-box-like	586	620	2.8e-11	43.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GXC7`	Arabidopsis thaliana	F-box/kelch-repeat protein At3g06240	26.087%	Swiss-Prot	weak database homology
`Q9LU24`	Arabidopsis thaliana	Putative F-box protein At3g16210	26.316%	Swiss-Prot	weak database homology
`Q9SS35`	Arabidopsis thaliana	Putative F-box protein At3g10240	26.608%	Swiss-Prot	weak database homology
`Q9FZF8`	Arabidopsis thaliana	Putative F-box protein At1g47790	28.125%	Swiss-Prot	weak database homology
`Q9T0J4`	Arabidopsis thaliana	Putative F-box protein At4g38870	29.000%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card