LXL04_025282 | RubberDandelionOmics

Gene overview

LXL04_025282

Reference: OH-1004 Chr: Chr05 Coordinates: 109118006-109125613 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4206 bp · LXL04_025282|LXL04_025282|OH1004|cDNA

ATGAAAGCTCTATTTAGAAGATTAACATATTCTCCATCTCGTGTTATTATATTCATCTTCCTGATCCCCATTCACATTGCTGTAGTTGGAGCAGATACATTTGACACTTTATCTATTCAAAGAGAGATTAATGGCCATCGACCCTTGTTTGACTGTCCTGAATGTATAGATAACAAGGAACAAGCTAACACAAGCTCTATGACAGCTGGAAACCATCAATTAGAGAAGGATATTGACATAATAGTGACATACACAGACAC...

CDS

Download CDS FASTA

4206 bp · LXL04_025282|LXL04_025282|OH1004|CDS

ATGAAAGCTCTATTTAGAAGATTAACATATTCTCCATCTCGTGTTATTATATTCATCTTCCTGATCCCCATTCACATTGCTGTAGTTGGAGCAGATACATTTGACACTTTATCTATTCAAAGAGAGATTAATGGCCATCGACCCTTGTTTGACTGTCCTGAATGTATAGATAACAAGGAACAAGCTAACACAAGCTCTATGACAGCTGGAAACCATCAATTAGAGAAGGATATTGACATAATAGTGACATACACAGACAC...

Protein

Download Protein FASTA

1401 aa · LXL04_025282|LXL04_025282|OH1004|PROTEIN

MKALFRRLTYSPSRVIIFIFLIPIHIAVVGADTFDTLSIQREINGHRPLFDCPECIDNKEQANTSSMTAGNHQLEKDIDIIVTYTDTSGAIRIKTIKSKNLSPSWVWKNPIDDNQVKKKSTVQNQPDTRIQNNNELLTDINKQPHKPSFPVHPAKLRRQALRQERRDRRTAELIQVAEKRDIQMQEAAIERAKTFDTSVKAKYSIWRREYESPNSDSTVKLMRDQIIMAKAYATIAKAKNATGIYDSLIKHSKRSQLAIG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025282`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025282

Location Chr05:109118006-109125613 (+)

Description Similar to GAUT3: Probable galacturonosyltransferase 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g38270`	May be involved in pectin and/or xylans biosynthesis in cell walls.	No verified direct reference in this release
`At3g61130`	Involved in pectin biosynthesis.	Functional identification of an Arabidopsis pectin biosynthetic homogalacturonan galacturonosyltransferase.2006 · DOI: 10.1073/pnas.0600120103
`At2g17210`	Pentatricopeptide repeat-containing protein At2g17210.	No verified direct reference in this release
`At5g47780`	May be involved in pectin and/or xylans biosynthesis in cell walls.	No verified direct reference in this release
`At2g46480`	May be involved in pectin and/or xylans biosynthesis in cell walls.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025282 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009451 RNA modification Biological Process

GO:0010289 homogalacturonan biosynthetic process Biological Process

GO:0045489 pectin biosynthetic process Biological Process

GO:0071555 cell wall organization Biological Process

GO:0000137 Golgi cis cisterna Cellular Component

GO:0000139 Golgi membrane Cellular Component

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005797 Golgi medial cisterna Cellular Component

KEGG gene cross-reference

ath:AT2G17210

ath:AT2G46480

ath:AT3G61130

ath:AT4G38270

ath:AT5G47780

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.560

Rank 1 · LXL04_025282 · OH-1004

Mitochondrion0.252

Rank 2 · LXL04_025282 · OH-1004

Nucleus0.043

Rank 3 · LXL04_025282 · OH-1004

Cytoplasm0.034

Rank 4 · LXL04_025282 · OH-1004

Endoplasmic reticulum0.032

Rank 5 · LXL04_025282 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25557.3GAUT_1215-291 aa

PF01501.27Glyco_transf_8341-650 aa

PF13041.13PPR_2780-824 aa

PF13041.13PPR_2879-911 aa

PF01535.27PPR882-910 aa

PF13041.13PPR_2979-1019 aa

PF13041.13PPR_21080-1127 aa

PF12854.14PPR_11080-1108 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025282	`PF25557.3`	GAUT_1	215	291	7.3e-26	90.9
LXL04_025282	`PF01501.27`	Glyco_transf_8	341	650	8e-80	268.8
LXL04_025282	`PF13041.13`	PPR_2	780	824	1.2e-55	186.1
LXL04_025282	`PF13041.13`	PPR_2	879	911	1.2e-55	186.1
LXL04_025282	`PF01535.27`	PPR	882	910	1.1e-45	151.4
LXL04_025282	`PF13041.13`	PPR_2	979	1019	1.2e-55	186.1
LXL04_025282	`PF13041.13`	PPR_2	1080	1127	1.2e-55	186.1
LXL04_025282	`PF12854.14`	PPR_1	1080	1108	1.2e-22	80.1
LXL04_025282	`PF01535.27`	PPR	1083	1111	1.1e-45	151.4
LXL04_025282	`PF13041.13`	PPR_2	1181	1229	1.2e-55	186.1
LXL04_025282	`PF20431.5`	E_motif	1310	1364	6.1e-10	39.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WQD2`	Arabidopsis thaliana	Probable galacturonosyltransferase 3	62.064%	Swiss-Prot	weak database homology
`Q9LE59`	Arabidopsis thaliana	Polygalacturonate 4-alpha-galacturonosyltransferase	61.279%	Swiss-Prot	weak database homology
`Q9SII7`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At2g17210	44.399%	Swiss-Prot	moderate database homology
`Q93ZX7`	Arabidopsis thaliana	Probable galacturonosyltransferase 4	60.526%	Swiss-Prot	weak database homology
`Q9ZPZ1`	Arabidopsis thaliana	Putative galacturonosyltransferase 2	51.445%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card