Gene Card
Gene overview
cDNA / CDS / Protein Sequences
753 bp · LXL04_025133|LXL04_025133|OH1004|cDNA
ATGGAGATTGATCCACATAATCCAGAAGGTGAAGCGGACAAAATTGTGATGGTTAAGGACGACGATCTCTTCAGAGCCGCCGACAACGGCGACGTTTCATTTTTCCAGTCCCTTCCTCAGCCACAGCTGCTACGTTGTCTCGCTCTTCGTAACGAAGACGGACGATCGCTACTTCATGTCTCCGTTTCGTCAGCCCGCACCGAGGTGGTGAAGATACTCGCAGCTTTTGATCAATCAATCAGTGGCATTAACGATGCTGA...
753 bp · LXL04_025133|LXL04_025133|OH1004|CDS
ATGGAGATTGATCCACATAATCCAGAAGGTGAAGCGGACAAAATTGTGATGGTTAAGGACGACGATCTCTTCAGAGCCGCCGACAACGGCGACGTTTCATTTTTCCAGTCCCTTCCTCAGCCACAGCTGCTACGTTGTCTCGCTCTTCGTAACGAAGACGGACGATCGCTACTTCATGTCTCCGTTTCGTCAGCCCGCACCGAGGTGGTGAAGATACTCGCAGCTTTTGATCAATCAATCAGTGGCATTAACGATGCTGA...
Protein
Download Protein FASTA250 aa · LXL04_025133|LXL04_025133|OH1004|PROTEIN
MEIDPHNPEGEADKIVMVKDDDLFRAADNGDVSFFQSLPQPQLLRCLALRNEDGRSLLHVSVSSARTEVVKILAAFDQSISGINDADEEGWAPLHSAASCGNVEIVKILLDRGADVNLKNDGGRTALHYAASKGWVKLAEILLSNGAKINSKDKACNVGCTPLHRAASTGKSEICELLIEEGADIDAVDRAGQTPIMSAVICYNKEVALLLIRHGADVDVEDKEGYTVLGRASDEFRPILIDAAKAMLEG
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_025133 |
|---|---|
| TK1151 ID | TkA06G079020 |
| OH-1004 ID | LXL04_025133 |
| Relationship / confidence | Multi Candidate From Tk1151 / Complex relationship |
| Protein identity (%) | 72.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_025133 |
|---|---|
| Location | Chr05:106624612-106625901 (+) |
| Description | Similar to psmD10: 26S proteasome non-ATPase regulatory subunit 10 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0030307 positive regulation of cell growth Biological Process GO:0031398 positive regulation of protein ubiquitination Biological Process GO:0032436 positive regulation of proteasomal ubiquitin-dependent protein catabolic process Biological Process GO:0043409 negative regulation of MAPK cascade Biological Process GO:0045737 positive regulation of cyclin-dependent protein serine/threonine kinase activity Biological Process GO:0070682 proteasome regulatory particle assembly Biological Process GO:0000502 proteasome complex Cellular Component GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component |
| KEGG gene cross-reference | ddi:DDB_G0289189 hsa:5716 mmu:53380 rno:116722 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF12796.14Ank_223-120 aaPF13637.13Ank_459-110 aaPF13857.13Ank_584-130 aaPF13606.13Ank_389-117 aaPF00023.37Ank90-121 aaPF13637.13Ank_4101-134 aaPF13857.13Ank_5109-154 aaPF12796.14Ank_2118-189 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_025133 | PF12796.14 | Ank_2 | 23 | 120 | 1.3e-41 | 141.7 |
| LXL04_025133 | PF13637.13 | Ank_4 | 59 | 110 | 8.8e-34 | 115.5 |
| LXL04_025133 | PF13857.13 | Ank_5 | 84 | 130 | 2e-30 | 105.2 |
| LXL04_025133 | PF13606.13 | Ank_3 | 89 | 117 | 1.5e-33 | 111.3 |
| LXL04_025133 | PF00023.37 | Ank | 90 | 121 | 6.7e-43 | 143.0 |
| LXL04_025133 | PF13637.13 | Ank_4 | 101 | 134 | 8.8e-34 | 115.5 |
| LXL04_025133 | PF13857.13 | Ank_5 | 109 | 154 | 2e-30 | 105.2 |
| LXL04_025133 | PF12796.14 | Ank_2 | 118 | 189 | 1.3e-41 | 141.7 |
| LXL04_025133 | PF00023.37 | Ank | 123 | 154 | 6.7e-43 | 143.0 |
| LXL04_025133 | PF13606.13 | Ank_3 | 123 | 150 | 1.5e-33 | 111.3 |
| LXL04_025133 | PF13637.13 | Ank_4 | 127 | 179 | 8.8e-34 | 115.5 |
| LXL04_025133 | PF13857.13 | Ank_5 | 154 | 196 | 2e-30 | 105.2 |
| LXL04_025133 | PF00023.37 | Ank | 159 | 190 | 6.7e-43 | 143.0 |
| LXL04_025133 | PF13606.13 | Ank_3 | 159 | 187 | 1.5e-33 | 111.3 |
| LXL04_025133 | PF13637.13 | Ank_4 | 173 | 212 | 8.8e-34 | 115.5 |
| LXL04_025133 | PF13857.13 | Ank_5 | 178 | 229 | 2e-30 | 105.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.