LXL04_024964 | RubberDandelionOmics

Gene overview

LXL04_024964

Reference: OH-1004 Chr: Chr05 Coordinates: 102970285-102971541 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1257 bp · LXL04_024964|LXL04_024964|OH1004|cDNA

ATGTCCGGTGTCGGTATATTCTTCGGGTGTAAGATATGGGCTGATAAGATGCCCTATTTCAAGGCCCAACTTCAAGAAGCTTCACACATTCAACGGAGGAATATTCCGTCGGTCTTCAGTTTAAACTTTACATACCCCTCGAATATATCCCACTCTTCTTTACCACCATCTATCTGTGCGTGCTTTTGTGTGTGTAACAAGTTACAGCTAAGAAAACCTAGGGAATCAACGGCCATGGCGGAACACCGTGTAAGCAAGAG...

CDS

Download CDS FASTA

1257 bp · LXL04_024964|LXL04_024964|OH1004|CDS

ATGTCCGGTGTCGGTATATTCTTCGGGTGTAAGATATGGGCTGATAAGATGCCCTATTTCAAGGCCCAACTTCAAGAAGCTTCACACATTCAACGGAGGAATATTCCGTCGGTCTTCAGTTTAAACTTTACATACCCCTCGAATATATCCCACTCTTCTTTACCACCATCTATCTGTGCGTGCTTTTGTGTGTGTAACAAGTTACAGCTAAGAAAACCTAGGGAATCAACGGCCATGGCGGAACACCGTGTAAGCAAGAG...

Protein

Download Protein FASTA

418 aa · LXL04_024964|LXL04_024964|OH1004|PROTEIN

MSGVGIFFGCKIWADKMPYFKAQLQEASHIQRRNIPSVFSLNFTYPSNISHSSLPPSICACFCVCNKLQLRKPRESTAMAEHRVSKRLRNYVSNKEQPEFTGKSLRKIRVICSDPEATDSSSDEADSGERSSPRRIVCEIVIGVKSDEGDEAVERKDSSDQTQRKKLTGVRLRKWGKWAAEIRDPFSRKRIWLGTYNTAEEASKAYTAKKQEFQARLSAPKPPKSDGESSTQVSHDADRCSMEEDEKETSLSGRVVPRHD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024964`
TK1151 ID	TkA06G093020
OH-1004 ID	LXL04_024964
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.900
Protein coverage (%)	TK1151 100.000 / OH-1004 81.340 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024964

Location Chr05:102970285-102971541 (+)

Description Similar to ERF118: Ethylene-responsive transcription factor ERF118

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g68550`	Probably acts as a transcriptional activator.	No verified direct reference in this release
`At4g11140`	Component of the cytokinin signaling pathway involved in cotyledons, leaves, and embryos development.	No verified direct reference in this release
`At4g27950`	Component of the cytokinin signaling pathway involved in cotyledons, leaves, and embryos development.	No verified direct reference in this release
`At5g53290`	Component of the cytokinin signaling pathway involved in cotyledons, leaves, and embryos development.	No verified direct reference in this release
`At2g46310`	Component of the cytokinin signaling pathway involved in cotyledons, leaves, and embryos development.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024964 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009736 cytokinin-activated signaling pathway Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0048366 leaf development Biological Process

GO:0048825 cotyledon development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT1G68550

ath:AT2G46310

ath:AT4G11140

ath:AT4G27950

ath:AT5G53290

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.897

Rank 1 · LXL04_024964 · OH-1004

Cytoplasm0.123

Rank 2 · LXL04_024964 · OH-1004

Cell membrane0.059

Rank 3 · LXL04_024964 · OH-1004

Endoplasmic reticulum0.042

Rank 4 · LXL04_024964 · OH-1004

Plastid0.024

Rank 5 · LXL04_024964 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00847.27AP2167-211 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024964	`PF00847.27`	AP2	167	211	1.3e-09	38.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9CA27`	Arabidopsis thaliana	Ethylene-responsive transcription factor ERF118	40.719%	Swiss-Prot	weak database homology
`O82503`	Arabidopsis thaliana	Ethylene-responsive transcription factor CRF1	39.216%	Swiss-Prot	weak database homology
`Q9SUE3`	Arabidopsis thaliana	Ethylene-responsive transcription factor CRF4	39.456%	Swiss-Prot	weak database homology
`Q9FK12`	Arabidopsis thaliana	Ethylene-responsive transcription factor CRF3	40.260%	Swiss-Prot	weak database homology
`O82339`	Arabidopsis thaliana	Ethylene-responsive transcription factor CRF5	45.045%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card