LXL04_024939 | RubberDandelionOmics

Gene overview

LXL04_024939

Reference: OH-1004 Chr: Chr05 Coordinates: 102493543-102494918 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

966 bp · LXL04_024939|LXL04_024939|OH1004|cDNA

ATGGAATACAACTGCAAGGAATTCAAGGTAGGGAAATGTGAAGGTGAAAAGCTGGTCGATGGTGAAACCCTGCCATTGGTGCTCACACCTCCGGAGCCATGCAAAACGGGGATAGAGTCGTTATTAGAATCTCTAAAGAACAACAAAGAATGGTTTGATGAGATGATTGTGAAGAATAGTGCGGTTCTTTTACGAGGATTTGATGTGAAGAATGCAGTTGAATTCAATGACATAGTCGAGACCTTCGACTGGGAGGATAT...

CDS

Download CDS FASTA

966 bp · LXL04_024939|LXL04_024939|OH1004|CDS

ATGGAATACAACTGCAAGGAATTCAAGGTAGGGAAATGTGAAGGTGAAAAGCTGGTCGATGGTGAAACCCTGCCATTGGTGCTCACACCTCCGGAGCCATGCAAAACGGGGATAGAGTCGTTATTAGAATCTCTAAAGAACAACAAAGAATGGTTTGATGAGATGATTGTGAAGAATAGTGCGGTTCTTTTACGAGGATTTGATGTGAAGAATGCAGTTGAATTCAATGACATAGTCGAGACCTTCGACTGGGAGGATAT...

Protein

Download Protein FASTA

321 aa · LXL04_024939|LXL04_024939|OH1004|PROTEIN

MEYNCKEFKVGKCEGEKLVDGETLPLVLTPPEPCKTGIESLLESLKNNKEWFDEMIVKNSAVLLRGFDVKNAVEFNDIVETFDWEDIRYVGPAPRTHIHKRVWTANEGPLSEFIYYHHEMVLIKEFPKKVILFCEIPPPEGGETPFVPSFKVTERMLEEFPEFVEEVEAKGLKYTFTALSNDNTTSMRGRGWQDAFGTPDKEEAEKRARALGMDVEWLENGGVKTILGPRALTKVFEGRKGRRMWFNTLVGMHGKELSSA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024939`
TK1151 ID	TkA06G094850
OH-1004 ID	LXL04_024939
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 91.189 / OH-1004 64.486 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024939

Location Chr05:102493543-102494918 (+)

Description Similar to At3g21360: Clavaminate synthase-like protein At3g21360

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g21360`	Clavaminate synthase-like protein At3g21360.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024939 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0017000 antibiotic biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0016491 oxidoreductase activity Molecular Function

GO:0016706 2-oxoglutarate-dependent dioxygenase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT3G21360

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.729

Rank 1 · LXL04_024939 · OH-1004

Nucleus0.284

Rank 2 · LXL04_024939 · OH-1004

Mitochondrion0.103

Rank 3 · LXL04_024939 · OH-1004

Peroxisome0.091

Rank 4 · LXL04_024939 · OH-1004

Cell membrane0.064

Rank 5 · LXL04_024939 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02668.23TauD41-317 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024939	`PF02668.23`	TauD	41	317	9.3e-29	101.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LIG0`	Arabidopsis thaliana	Clavaminate synthase-like protein At3g21360	41.195%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card