LXL04_024865 | RubberDandelionOmics

Gene overview

LXL04_024865

Reference: OH-1004 Chr: Chr05 Coordinates: 100960214-100966643 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2319 bp · LXL04_024865|LXL04_024865|OH1004|cDNA

ATGGTTCAGCACATGACGTTGGAGACTCATCCTGACCGCTTAGGATGGGTGGAGGATGTGTCGGACGGCTTCTCGGTGGCCTCTGCTCGCAGGTGGCTGGATCGGATTACGTTGTTTCGTGGTGGGGATGTTACGACTTGGAATAATTGGGTTCCTATTAAACTCTGTGTCCTTCTGTGGCGTATCCGTCTTTCGGGAATTCCTACTAGGGAGAGGCTGTCGGCTCGGGGCATTATGGTTGACTCCATCATGTGTCCGGT...

CDS

Download CDS FASTA

2319 bp · LXL04_024865|LXL04_024865|OH1004|CDS

ATGGTTCAGCACATGACGTTGGAGACTCATCCTGACCGCTTAGGATGGGTGGAGGATGTGTCGGACGGCTTCTCGGTGGCCTCTGCTCGCAGGTGGCTGGATCGGATTACGTTGTTTCGTGGTGGGGATGTTACGACTTGGAATAATTGGGTTCCTATTAAACTCTGTGTCCTTCTGTGGCGTATCCGTCTTTCGGGAATTCCTACTAGGGAGAGGCTGTCGGCTCGGGGCATTATGGTTGACTCCATCATGTGTCCGGT...

Protein

Download Protein FASTA

772 aa · LXL04_024865|LXL04_024865|OH1004|PROTEIN

MVQHMTLETHPDRLGWVEDVSDGFSVASARRWLDRITLFRGGDVTTWNNWVPIKLCVLLWRIRLSGIPTRERLSARGIMVDSIMCPVCGRAVETIDHIFAGCSQLREVWCNNPNNYMNKIKGCELRNKTRLGPNIYKVVIMSSRRSRRFTRVTGEEGGNHIEANPTEPDDVFGVSVIPPVGRGRGQRRGSNAIGVNATEGGGMYEAPVVPTVGRGRGQRRANVMEPGGVPETPLIPTVGRGRGQRRGTGRGRGRGRGDTT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024865`
TK1151 ID	TkA01G306320
OH-1004 ID	LXL04_024865
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	86.900
Protein coverage (%)	TK1151 93.855 / OH-1004 21.762 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_024865`
Location	Chr05:100960214-100966643 (-)
Description	Similar to gag: Gag polyprotein (Equine infectious anemia virus (strain Wyoming)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_024865` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0002218 activation of innate immune response Biological Process GO:0009597 detection of virus Biological Process GO:0032481 positive regulation of type I interferon production Biological Process GO:0039702 viral budding via host ESCRT complex Biological Process GO:0045087 innate immune response Biological Process GO:0051607 defense response to virus Biological Process GO:0071360 cellular response to exogenous dsRNA Biological Process GO:1900246 positive regulation of RIG-I signaling pathway Biological Process GO:0005737 cytoplasm Cellular Component GO:0019013 viral nucleocapsid Cellular Component GO:0003676 nucleic acid binding Molecular Function GO:0003690 double-stranded DNA binding Molecular Function
KEGG gene cross-reference	hsa:85364 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.618

Rank 1 · LXL04_024865 · OH-1004

Cytoplasm0.357

Rank 2 · LXL04_024865 · OH-1004

Cell membrane0.052

Rank 3 · LXL04_024865 · OH-1004

Mitochondrion0.037

Rank 4 · LXL04_024865 · OH-1004

Endoplasmic reticulum0.032

Rank 5 · LXL04_024865 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13966.12zf-RVT45-109 aa

PF19259.5Ty3_capsid364-477 aa

PF03732.25PEG10_N-capsid369-447 aa

PF00098.29zf-CCHC568-584 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024865	`PF13966.12`	zf-RVT	45	109	6.1e-14	53.2
LXL04_024865	`PF19259.5`	Ty3_capsid	364	477	1.8e-08	34.8
LXL04_024865	`PF03732.25`	PEG10_N-capsid	369	447	4.7e-11	43.6
LXL04_024865	`PF00098.29`	zf-CCHC	568	584	1.7e-07	31.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card