LXL04_024837 | RubberDandelionOmics

Gene overview

LXL04_024837

Reference: OH-1004 Chr: Chr05 Coordinates: 100163602-100172587 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3558 bp · LXL04_024837|LXL04_024837|OH1004|cDNA

atgggtgcccgtgaaccagatcccaaactgttggcaatagaaacagagttcatgttggaGTCGGTTACTGTAGCAGCCGGGTACTGTTCACGTCCGGGTTCGGTTGATGAGTCGTTGCCGAGCACTGTTCATCGTAGCCGAGTGGTGTCCGAGAAAAGTAGTCGCTGGCCGAGAATGGCCGAGAATGCCGATCAGGCATATCGTCGAACACATGGTGTGCGTGGGTGTTGGTCGAGCAGTGTCCGAGATCTTTGGTTGCG...

CDS

Download CDS FASTA

3558 bp · LXL04_024837|LXL04_024837|OH1004|CDS

ATGGGTGCCCGTGAACCAGATCCCAAACTGTTGGCAATAGAAACAGAGTTCATGTTGGAGTCGGTTACTGTAGCAGCCGGGTACTGTTCACGTCCGGGTTCGGTTGATGAGTCGTTGCCGAGCACTGTTCATCGTAGCCGAGTGGTGTCCGAGAAAAGTAGTCGCTGGCCGAGAATGGCCGAGAATGCCGATCAGGCATATCGTCGAACACATGGTGTGCGTGGGTGTTGGTCGAGCAGTGTCCGAGATCTTTGGTTGCG...

Protein

Download Protein FASTA

1185 aa · LXL04_024837|LXL04_024837|OH1004|PROTEIN

MGAREPDPKLLAIETEFMLESVTVAAGYCSRPGSVDESLPSTVHRSRVVSEKSSRWPRMAENADQAYRRTHGVRGCWSSSVRDLWLRLAFVRVVAELAFHRAGGVHEDLGRCRAVSEVVPGKLGRCRGSITSSTWCASAVSEKFGRCRGRDRVVPRMCRWCPSKAWSLSGRHFNKHLVGMGELERVAGHGSGSWAWARGLDSENEAMEKTCTLLVHFDKGTPALANEIKEALEGNDDAAKIDAMKKAVMLLLNGETLPQL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024837`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024837

Location Chr05:100163602-100172587 (-)

Description Similar to At4g31480: Coatomer subunit beta-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g31480`	The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network.	No verified direct reference in this release
`At4g31490`	The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0174000`	The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network.	No verified direct reference in this release
`Os01g0281400`	The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024837 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process

GO:0006891 intra-Golgi vesicle-mediated transport Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0030126 COPI vesicle coat Cellular Component

GO:0005198 structural molecule activity Molecular Function

KEGG gene cross-reference

ath:AT4G31480

ath:AT4G31490

dosa:Os01g0281400

dosa:Os11g0174000

dpo:4814235

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.501

Rank 1 · LXL04_024837 · OH-1004

Golgi apparatus0.315

Rank 2 · LXL04_024837 · OH-1004

Nucleus0.212

Rank 3 · LXL04_024837 · OH-1004

Lysosome / Vacuole0.137

Rank 4 · LXL04_024837 · OH-1004

Cell membrane0.132

Rank 5 · LXL04_024837 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01602.27Adaptin_N226-674 aa

PF07718.19Coatamer_beta_C875-1013 aa

PF14806.12Coatomer_b_Cpla1019-1140 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024837	`PF01602.27`	Adaptin_N	226	674	2e-90	304.6
LXL04_024837	`PF07718.19`	Coatamer_beta_C	875	1013	3.1e-56	189.8
LXL04_024837	`PF14806.12`	Coatomer_b_Cpla	1019	1140	3.8e-53	179.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SV21`	Arabidopsis thaliana	Coatomer subunit beta-1	83.405%	Swiss-Prot	strong database homology
`Q9SV20`	Arabidopsis thaliana	Coatomer subunit beta-2	82.976%	Swiss-Prot	strong database homology
`Q53PC7`	Oryza sativa subsp. japonica	Coatomer subunit beta-1	79.424%	Swiss-Prot	strong database homology
`Q0JNK5`	Oryza sativa subsp. japonica	Coatomer subunit beta-2	77.908%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card