LXL04_024811 | RubberDandelionOmics

Gene overview

LXL04_024811

Reference: OH-1004 Chr: Chr05 Coordinates: 99410592-99413379 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1842 bp · LXL04_024811|LXL04_024811|OH1004|cDNA

ATGGCACCTGTTTCATTGCCTCCTGGTTTCCGTTTTCATCCCACAGACGAGGAACTTGTCGCATATTATCTCAAACGGAAAATTAATGGCCATGAAATCGAGCTTGAAGTTATTCCTGAGGTTGATCTATACAAGTGCGAACCATGGGATTTACCAGGGAAATCGTTGTTGCCAAGCAAAGACTTAGAATGGTACTTCTTTAGTCCAAGAGATCGCAAATACCCAAATGGATCAAGAACAAACCGAGCCACGAAAGGTGG...

CDS

Download CDS FASTA

1842 bp · LXL04_024811|LXL04_024811|OH1004|CDS

ATGGCACCTGTTTCATTGCCTCCTGGTTTCCGTTTTCATCCCACAGACGAGGAACTTGTCGCATATTATCTCAAACGGAAAATTAATGGCCATGAAATCGAGCTTGAAGTTATTCCTGAGGTTGATCTATACAAGTGCGAACCATGGGATTTACCAGGGAAATCGTTGTTGCCAAGCAAAGACTTAGAATGGTACTTCTTTAGTCCAAGAGATCGCAAATACCCAAATGGATCAAGAACAAACCGAGCCACGAAAGGTGG...

Protein

Download Protein FASTA

613 aa · LXL04_024811|LXL04_024811|OH1004|PROTEIN

MAPVSLPPGFRFHPTDEELVAYYLKRKINGHEIELEVIPEVDLYKCEPWDLPGKSLLPSKDLEWYFFSPRDRKYPNGSRTNRATKGGYWKATGKDRKVNSQSRAMGMKKTLVYYRGRAPHGSRTDWVMHEYRLDERECETASGLQLQDAYSLCRVFKKSLIPPKPTVTGDPYNATAASDLSSCIDLYNSEGGRGSGEEMETCNNYQTPSMASSSSSILHGSHNLINHTNHDVKWTQYLSEDAFTFANPSFSNSVNLPNYP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024811`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024811

Location Chr05:99410592-99413379 (-)

Description Similar to NAC086: NAC domain-containing protein 86

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g17260`	Transcription factor directing sieve element enucleation and cytosol degradation.	No verified direct reference in this release
`At3g03200`	Transcription factor directing sieve element enucleation and cytosol degradation.	No verified direct reference in this release
`At4g17980`	Transcription factor involved in tissue reunion of wounded inflorescence stems.	No verified direct reference in this release
`At5g46590`	Transcriptional activator involved in the positive regulation of abscisic acid (ABA) responsive genes.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0119966`	Transcription factor that functions as a regulator of the jasmonate (JA) signaling pathway.	Disruption of a novel gene for a NAC-domain protein in rice confers resistance to Rice dwarf virus.2009 · DOI: 10.1111/j.1365-313x.2008.03712.x The NAC transcription factor RIM1 of rice is a new regulator of jasmonate signaling.2010 · DOI: 10.1111/j.1365-313x.2009.04107.x

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024811 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009611 response to wounding Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process

GO:0051301 cell division Biological Process

GO:0071365 cellular response to auxin stimulus Biological Process

GO:0090602 sieve element enucleation Biological Process

GO:0090603 sieve element differentiation Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G03200

ath:AT4G17980

ath:AT5G17260

ath:AT5G46590

dosa:Os03g0119966

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.906

Rank 1 · LXL04_024811 · OH-1004

Cytoplasm0.129

Rank 2 · LXL04_024811 · OH-1004

Cell membrane0.070

Rank 3 · LXL04_024811 · OH-1004

Endoplasmic reticulum0.062

Rank 4 · LXL04_024811 · OH-1004

Plastid0.022

Rank 5 · LXL04_024811 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02365.21NAM7-133 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024811	`PF02365.21`	NAM	7	133	8.3e-52	175.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FFI5`	Arabidopsis thaliana	NAC domain-containing protein 86	42.500%	Swiss-Prot	moderate database homology
`A4VCM0`	Arabidopsis thaliana	NAC domain-containing protein 45	41.667%	Swiss-Prot	moderate database homology
`O49697`	Arabidopsis thaliana	NAC domain-containing protein 71	52.055%	Swiss-Prot	weak database homology
`Q9LS24`	Arabidopsis thaliana	NAC domain-containing protein 96	63.190%	Swiss-Prot	weak database homology
`Q8H045`	Oryza sativa subsp. japonica	NAC domain-containing protein 54	47.088%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card