LXL04_024584 | RubberDandelionOmics

Gene overview

LXL04_024584

Reference: OH-1004 Chr: Chr05 Coordinates: 94351800-94352522 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

627 bp · LXL04_024584|LXL04_024584|OH1004|cDNA

ATGCACAATCATCCACCCAGCTCTTTCTCCATGTTTCTCACCATGCCTTACGATCAAAACATCTCTTCCCCTTCTTCCGTTGATTGCACTCTTTCTTTAGCCACGCCGTCTACCCGTCTAGCCTCCGACGACTTCGACTCGCCGGAATCTCGACCTTCCTCGCGCTTCTGCTGGGACTTTTTACAGTCCGATAACCACTCACCGGCTCCGCCTTCTTATAAACCCAACCGCGGTAACAATACCAACGTCTCCTCCGTTGA...

CDS

Download CDS FASTA

627 bp · LXL04_024584|LXL04_024584|OH1004|CDS

ATGCACAATCATCCACCCAGCTCTTTCTCCATGTTTCTCACCATGCCTTACGATCAAAACATCTCTTCCCCTTCTTCCGTTGATTGCACTCTTTCTTTAGCCACGCCGTCTACCCGTCTAGCCTCCGACGACTTCGACTCGCCGGAATCTCGACCTTCCTCGCGCTTCTGCTGGGACTTTTTACAGTCCGATAACCACTCACCGGCTCCGCCTTCTTATAAACCCAACCGCGGTAACAATACCAACGTCTCCTCCGTTGA...

Protein

Download Protein FASTA

208 aa · LXL04_024584|LXL04_024584|OH1004|PROTEIN

MHNHPPSSFSMFLTMPYDQNISSPSSVDCTLSLATPSTRLASDDFDSPESRPSSRFCWDFLQSDNHSPAPPSYKPNRGNNTNVSSVDALLARRCANCDTTSTPLWRNGPRGPKSLCNACGIRFKKEERRANATATAGGGGDATEEYNGNAWMHHIQGSTNKLPSYYSPAGVGNEFRFIDDVDDRDSTFLSWRLNVTDRVGLVHDFTRY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024584`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024584

Location Chr05:94351800-94352522 (+)

Description Similar to GATA18: GATA transcription factor 18

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g50870`	Transcriptional factor that specifically binds 5'-GATA-3' or 5'-GAT-3' motifs within gene promoters (including its own promoter and GATA21 promoter), thus regulating the expression of genes mostly involved in hormone responses and floral organ specification (including genes regulating hormones responses).	No verified direct reference in this release
`At4g36620`	Transcriptional regulator that specifically binds 5'-GATA-3' or 5'-GAT-3' motifs within gene promoters.	Transcription repressor HANABA TARANU controls flower development by integrating the actions of multiple hormones, floral organ specification genes, and GATA3 family genes in Arabidopsis.2013 · DOI: 10.1105/tpc.112.107854
`At2g18380`	Transcriptional regulator that specifically binds 5'-GATA-3' or 5'-GAT-3' motifs within gene promoters.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0578900`	Probable transcription factor that regulates organogenesis during transition from the vegetative to the reproductive phase.	No verified direct reference in this release
`UniProt: B8AX51`	Probable transcription factor that regulates organogenesis during transition from the vegetative to the reproductive phase.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024584 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009908 flower development Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0009934 regulation of meristem structural organization Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0048437 floral organ development Biological Process

GO:0048510 regulation of timing of transition from vegetative to reproductive phase Biological Process

GO:0048825 cotyledon development Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

KEGG gene cross-reference

ath:AT2G18380

ath:AT3G50870

ath:AT4G36620

dosa:Os05g0578900

osa:4339709

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.885

Rank 1 · LXL04_024584 · OH-1004

Cytoplasm0.231

Rank 2 · LXL04_024584 · OH-1004

Cell membrane0.024

Rank 3 · LXL04_024584 · OH-1004

Mitochondrion0.018

Rank 4 · LXL04_024584 · OH-1004

Endoplasmic reticulum0.016

Rank 5 · LXL04_024584 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00320.34GATA94-128 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024584	`PF00320.34`	GATA	94	128	1e-17	64.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LC79`	Arabidopsis thaliana	GATA transcription factor 18	42.966%	Swiss-Prot	moderate database homology
`Q6QPM2`	Arabidopsis thaliana	GATA transcription factor 19	49.115%	Swiss-Prot	moderate database homology
`Q9ZPX0`	Arabidopsis thaliana	GATA transcription factor 20	43.119%	Swiss-Prot	moderate database homology
`Q6L5E5`	Oryza sativa subsp. japonica	GATA transcription factor 15	47.826%	Swiss-Prot	weak database homology
`B8AX51`	Oryza sativa subsp. indica	GATA transcription factor 15	47.826%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card