LXL04_024525 | RubberDandelionOmics

Gene overview

LXL04_024525

Reference: OH-1004 Chr: Chr05 Coordinates: 92991560-92995050 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1854 bp · LXL04_024525|LXL04_024525|OH1004|cDNA

ATGGAGAAAACTCGATCACTGTTGATTTTATATGCCACTGAAACGGGAAACGCGTTAGATGCGGCGGAACAATTGTGCCGCGAAGCTGAAAGAAGAGGTTGCCCCGTTCGTATCTTTTCTCTTGACGAATTTGATCCCAGCTCCTTACCATGTGAAGAATTTGTAATTTTTGTTGTGTCGACAACTGGACAAGGGGACACCCCCAATCCCATGAAGGCATTTTGGACATTTCTTTTACAAAGAAGTTTAGGTCAACAATG...

CDS

Download CDS FASTA

1854 bp · LXL04_024525|LXL04_024525|OH1004|CDS

ATGGAGAAAACTCGATCACTGTTGATTTTATATGCCACTGAAACGGGAAACGCGTTAGATGCGGCGGAACAATTGTGCCGCGAAGCTGAAAGAAGAGGTTGCCCCGTTCGTATCTTTTCTCTTGACGAATTTGATCCCAGCTCCTTACCATGTGAAGAATTTGTAATTTTTGTTGTGTCGACAACTGGACAAGGGGACACCCCCAATCCCATGAAGGCATTTTGGACATTTCTTTTACAAAGAAGTTTAGGTCAACAATG...

Protein

Download Protein FASTA

617 aa · LXL04_024525|LXL04_024525|OH1004|PROTEIN

MEKTRSLLILYATETGNALDAAEQLCREAERRGCPVRIFSLDEFDPSSLPCEEFVIFVVSTTGQGDTPNPMKAFWTFLLQRSLGQQWLKNTHYAVFGLGDSGYQKYNFAAKKLDKRLADLGGTSVIERGLGDDQHPSGYEGALDPWMSSLWTMLYNQNPKFFPKGLDISVSDIKQLGQPKVDITYLDSDSVYSQSSSQIDLKSLEKDIVRCRSILSGKKSNNPDCFLKLVKNQPITRADCGKDVRHFEFEPLSSNIEYEV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024525`
TK1151 ID	TkA06G134710
OH-1004 ID	LXL04_024525
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024525

Location Chr05:92991560-92995050 (-)

Description Similar to ATR3: NADPH-dependent diflavin oxidoreductase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g02280`	NADPH-dependent reductase which is a central component of the cytosolic iron-sulfur (Fe-S) protein assembly (CIA) machinery.	ATR3 encodes a diflavin reductase essential for Arabidopsis embryo development.2010 · DOI: 10.1111/j.1469-8137.2010.03254.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024525 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0016226 iron-sulfur cluster assembly Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0048471 perinuclear region of cytoplasm Cellular Component

GO:0009055 electron transfer activity Molecular Function

GO:0010181 FMN binding Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0016651 oxidoreductase activity, acting on NAD(P)H Molecular Function

GO:0016653 oxidoreductase activity, acting on NAD(P)H, heme protein as acceptor Molecular Function

GO:0050660 flavin adenine dinucleotide binding Molecular Function

KEGG gene cross-reference

ath:AT3G02280

bta:513873

ddi:DDB_G0287983

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.626

Rank 1 · LXL04_024525 · OH-1004

Nucleus0.376

Rank 2 · LXL04_024525 · OH-1004

Mitochondrion0.122

Rank 3 · LXL04_024525 · OH-1004

Cell membrane0.061

Rank 4 · LXL04_024525 · OH-1004

Endoplasmic reticulum0.053

Rank 5 · LXL04_024525 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00258.31Flavodoxin_19-146 aa

PF00667.27FAD_binding_1225-435 aa

PF00175.27NAD_binding_1467-575 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024525	`PF00258.31`	Flavodoxin_1	9	146	1e-36	126.9
LXL04_024525	`PF00667.27`	FAD_binding_1	225	435	7.1e-46	157.3
LXL04_024525	`PF00175.27`	NAD_binding_1	467	575	6.4e-12	46.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6NPS8`	Arabidopsis thaliana	NADPH-dependent diflavin oxidoreductase 1	63.796%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card