LXL04_024488 | RubberDandelionOmics

Gene overview

LXL04_024488

Reference: OH-1004 Chr: Chr05 Coordinates: 91918416-91926623 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2883 bp · LXL04_024488|LXL04_024488|OH1004|cDNA

ATGGAAACGGCGGAGGGGAGGCCAAATGTGGAAAGATGGACCGCTTACCGTCGCGAGGTAAAGAAGATCAGTCTAATCGCGGTGCCCATGGTGGTGGTTGCGGCGTTGCAGTACCTGATGCAAATGGCGGCGGTGGTAATGGTGGGACATGTTGATCAACTATCTCTCTCTAGCCTCGCCATTGCCACCTCTCTAACAAATGTCACCGGTTTCAGTCTTCTCTCAGGACTTGTTGGAGGATTAGAGACCCTTTGTGGGCA...

CDS

Download CDS FASTA

2883 bp · LXL04_024488|LXL04_024488|OH1004|CDS

ATGGAAACGGCGGAGGGGAGGCCAAATGTGGAAAGATGGACCGCTTACCGTCGCGAGGTAAAGAAGATCAGTCTAATCGCGGTGCCCATGGTGGTGGTTGCGGCGTTGCAGTACCTGATGCAAATGGCGGCGGTGGTAATGGTGGGACATGTTGATCAACTATCTCTCTCTAGCCTCGCCATTGCCACCTCTCTAACAAATGTCACCGGTTTCAGTCTTCTCTCAGGACTTGTTGGAGGATTAGAGACCCTTTGTGGGCA...

Protein

Download Protein FASTA

960 aa · LXL04_024488|LXL04_024488|OH1004|PROTEIN

METAEGRPNVERWTAYRREVKKISLIAVPMVVVAALQYLMQMAAVVMVGHVDQLSLSSLAIATSLTNVTGFSLLSGLVGGLETLCGQAYGAKQHNKIGVYTCSAIISLLLVSIPISVSWIFLDKFLILIHQDPQISHEARKYSLYLIPALFFGAIVKPLVRSLQSQSLTLPLLVSAALVLCFHVPLCWVLVFKLKMGGPGAAVAFSVSNLFYLILIVFYVRFSSTCENTRVTFSMDAVRGIKEFFRFAVPSAVMICLKWW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024488`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024488

Location Chr05:91918416-91926623 (+)

Description Similar to DTX14: Protein DETOXIFICATION 14

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g71140`	Protein DETOXIFICATION 14.	No verified direct reference in this release
`At2g04080`	Protein DETOXIFICATION 2.	No verified direct reference in this release
`At2g04040`	Efflux carrier for plant-derived alkaloids, antibiotics, heavy metal and other toxic compounds.	Functional cloning and characterization of a plant efflux carrier for multidrug and heavy metal detoxification.2002 · DOI: 10.1074/jbc.m108777200
`At2g04050`	Protein DETOXIFICATION 3.	No verified direct reference in this release
`At1g64820`	Protein DETOXIFICATION 7.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024488 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0015691 cadmium ion transport Biological Process

GO:0042908 xenobiotic transport Biological Process

GO:1990961 xenobiotic detoxification by transmembrane export across the plasma membrane Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0015297 antiporter activity Molecular Function

GO:0015562 efflux transmembrane transporter activity Molecular Function

GO:0022857 transmembrane transporter activity Molecular Function

GO:0042910 xenobiotic transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G71140

ath:AT2G04040

ath:AT2G04080

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.578

Rank 1 · LXL04_024488 · OH-1004

Lysosome / Vacuole0.172

Rank 2 · LXL04_024488 · OH-1004

Endoplasmic reticulum0.156

Rank 3 · LXL04_024488 · OH-1004

Cytoplasm0.088

Rank 4 · LXL04_024488 · OH-1004

Golgi apparatus0.065

Rank 5 · LXL04_024488 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01554.24MatE29-189 aa

PF01554.24MatE250-392 aa

PF01554.24MatE733-892 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024488	`PF01554.24`	MatE	29	189	1.3e-78	262.9
LXL04_024488	`PF01554.24`	MatE	250	392	1.3e-78	262.9
LXL04_024488	`PF01554.24`	MatE	733	892	1.3e-78	262.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C994`	Arabidopsis thaliana	Protein DETOXIFICATION 14	53.281%	Swiss-Prot	weak database homology
`Q8GXM8`	Arabidopsis thaliana	Protein DETOXIFICATION 2	52.279%	Swiss-Prot	weak database homology
`Q9SIA5`	Arabidopsis thaliana	Protein DETOXIFICATION 1	52.547%	Swiss-Prot	weak database homology
`Q9SIA4`	Arabidopsis thaliana	Protein DETOXIFICATION 3	52.547%	Swiss-Prot	weak database homology
`Q1PFG9`	Arabidopsis thaliana	Protein DETOXIFICATION 7	49.344%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card