LXL04_024409 | RubberDandelionOmics

Gene overview

LXL04_024409

Reference: OH-1004 Chr: Chr05 Coordinates: 89844692-89845824 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

903 bp · LXL04_024409|LXL04_024409|OH1004|cDNA

ATGTTAATGCCGGCGAGAATACGCCTCTTCACCCTTCGCGCCTCTTCACTCCTTCCGTCATCTTCCTCGCCGTCTCCTTTTTCACTATCTTTCAGAACCTCCATCTCCCACTCTCACTCCGCTCCTTCCCACCATGTCTCCGCCACTAAAACCCCCAAAATCTCCATCTCCGACACCGCCAAATTCGTCCGAACCGTCCTGTTTATCCCGCCCGGAACAGACCCAGAAGAAGTCACCGACGACATGATCTTACCCGGCTC...

CDS

Download CDS FASTA

903 bp · LXL04_024409|LXL04_024409|OH1004|CDS

ATGTTAATGCCGGCGAGAATACGCCTCTTCACCCTTCGCGCCTCTTCACTCCTTCCGTCATCTTCCTCGCCGTCTCCTTTTTCACTATCTTTCAGAACCTCCATCTCCCACTCTCACTCCGCTCCTTCCCACCATGTCTCCGCCACTAAAACCCCCAAAATCTCCATCTCCGACACCGCCAAATTCGTCCGAACCGTCCTGTTTATCCCGCCCGGAACAGACCCAGAAGAAGTCACCGACGACATGATCTTACCCGGCTC...

Protein

Download Protein FASTA

300 aa · LXL04_024409|LXL04_024409|OH1004|PROTEIN

MLMPARIRLFTLRASSLLPSSSSPSPFSLSFRTSISHSHSAPSHHVSATKTPKISISDTAKFVRTVLFIPPGTDPEEVTDDMILPGSNVVLGPYAGDAKVKEVQFIGSSIRPKDCPKDDRPEFAMLGRSNVGKSSLINSLVRKKEVALTSKKPGKTQLINHFLVNRSWYLVDLPGYGFANAPESARMDWSSFTKGYFLNRESLVSVLLLVDASVPPQKIDIDCANWLGRNNIPMTIVFTKCDKVKNSKGKRPDENIKNFQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024409`
TK1151 ID	TkA06G146860
OH-1004 ID	LXL04_024409
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024409

Location Chr05:89844692-89845824 (+)

Description Similar to EMB2001: GTP-binding protein At2g22870

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g22870`	GTP-binding protein At2g22870.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024409 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009507 chloroplast Cellular Component

GO:0005525 GTP binding Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT2G22870

bfr:BF2048

bfs:BF9343_2016

gfo:GFO_2778

pdi:BDI_1441

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.879

Rank 1 · LXL04_024409 · OH-1004

Plastid0.098

Rank 2 · LXL04_024409 · OH-1004

Nucleus0.054

Rank 3 · LXL04_024409 · OH-1004

Cytoplasm0.046

Rank 4 · LXL04_024409 · OH-1004

Cell membrane0.014

Rank 5 · LXL04_024409 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01926.30MMR_HSR1123-240 aa

PF03193.23RsgA_GTPase124-175 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024409	`PF01926.30`	MMR_HSR1	123	240	6.3e-19	68.9
LXL04_024409	`PF03193.23`	RsgA_GTPase	124	175	5.5e-07	30.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81004`	Arabidopsis thaliana	GTP-binding protein At2g22870	68.212%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card