LXL04_024333 | RubberDandelionOmics

Gene overview

LXL04_024333

Reference: OH-1004 Chr: Chr05 Coordinates: 87618248-87621265 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1272 bp · LXL04_024333|LXL04_024333|OH1004|cDNA

ATGTCTGAGAAAAAGCTCGTGGTATTGGGCATCCCCTGGGATATTGATACCGATGGTCTGAAGGATTACATGAGCAAATTTGGCGATTTGGAGGACTGTATCGTGATGAAGGAGCGCTCAAGTGGTCGATCACGTGGTTTTGGATATGTAACATTTGCAGCAGTTGAAGATGCCAAGGCAATTTGTATGTTGGCTGTCATGCAGGCTGCACTGGATAGTGAGCACTTCTTAGGGAATAGAGTGCTGGAAGTAAAAATAGC...

CDS

Download CDS FASTA

1272 bp · LXL04_024333|LXL04_024333|OH1004|CDS

ATGTCTGAGAAAAAGCTCGTGGTATTGGGCATCCCCTGGGATATTGATACCGATGGTCTGAAGGATTACATGAGCAAATTTGGCGATTTGGAGGACTGTATCGTGATGAAGGAGCGCTCAAGTGGTCGATCACGTGGTTTTGGATATGTAACATTTGCAGCAGTTGAAGATGCCAAGGCAATTTGTATGTTGGCTGTCATGCAGGCTGCACTGGATAGTGAGCACTTCTTAGGGAATAGAGTGCTGGAAGTAAAAATAGC...

Protein

Download Protein FASTA

423 aa · LXL04_024333|LXL04_024333|OH1004|PROTEIN

MSEKKLVVLGIPWDIDTDGLKDYMSKFGDLEDCIVMKERSSGRSRGFGYVTFAAVEDAKAICMLAVMQAALDSEHFLGNRVLEVKIATPKEEMRAPSKKVTRIFVARIPPSVTESDFRSHFDRFGEITDLYMPKDPSTKGHRGIGFITFATADSVDDLMSETHELGGSTVVVDRATPKAKYTIPLVFPEDDYRPVSRMVSRMSQSSGSSGGGGGGGGGGGGGGGGGYGAYNAYVTTRYAALGAPTSYDYPGPIYGRSEST...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024333`
TK1151 ID	TkAUNG019430
OH-1004 ID	LXL04_024333
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	95.400
Protein coverage (%)	TK1151 96.904 / OH-1004 76.359 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024333

Location Chr05:87618248-87621265 (-)

Description Similar to SPBC660.15: Uncharacterized RNA-binding protein C660.15 (Schizosaccharomyces pombe (strain 972 / ATCC 24843)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g14300`	Involved with pre-mRNA processing.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024333 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0051028 mRNA transport Biological Process

GO:0180010 co-transcriptional mRNA 3'-end processing, cleavage and polyadenylation pathway Biological Process

GO:1901000 regulation of response to salt stress Biological Process

GO:2000070 regulation of response to water deprivation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005681 spliceosomal complex Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005848 mRNA cleavage stimulating factor complex Cellular Component

KEGG gene cross-reference

ath:AT4G14300

spo:2541150

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.706

Rank 1 · LXL04_024333 · OH-1004

Cytoplasm0.463

Rank 2 · LXL04_024333 · OH-1004

Cell membrane0.051

Rank 3 · LXL04_024333 · OH-1004

Endoplasmic reticulum0.043

Rank 4 · LXL04_024333 · OH-1004

Extracellular0.026

Rank 5 · LXL04_024333 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076.29RRM_16-60 aa

PF00076.29RRM_1103-161 aa

PF00076.29RRM_1267-321 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024333	`PF00076.29`	RRM_1	6	60	2.7e-40	136.8
LXL04_024333	`PF00076.29`	RRM_1	103	161	2.7e-40	136.8
LXL04_024333	`PF00076.29`	RRM_1	267	321	2.7e-40	136.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W034`	Arabidopsis thaliana	Heterogeneous nuclear ribonucleoprotein 1	32.984%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card