LXL04_024273 | RubberDandelionOmics

Gene overview

LXL04_024273

Reference: OH-1004 Chr: Chr05 Coordinates: 86296311-86297534 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1224 bp · LXL04_024273|LXL04_024273|OH1004|cDNA

ATGAACTCCACACCGTCGTCGCCGGTGGCAAGTTCTAAATGGTCGTATCGTGAACAGGCGGCTCCCAATTGCACGGATTTTTCTGATTACACCGGATTGCTTGCTTCTCTTGTTCGTGAAGAGGGAAATATATATTCGTTGGCGGCAATCGGAGATATGTTGTACACCGGATCTGATAGCAAGAACATTCGCGTTTGGAAGAACCGCAAGGAATTTTCTGGATTCAAATCTAACAGCGGATTAGTTAAAGCGATTGTGAT...

CDS

Download CDS FASTA

1224 bp · LXL04_024273|LXL04_024273|OH1004|CDS

ATGAACTCCACACCGTCGTCGCCGGTGGCAAGTTCTAAATGGTCGTATCGTGAACAGGCGGCTCCCAATTGCACGGATTTTTCTGATTACACCGGATTGCTTGCTTCTCTTGTTCGTGAAGAGGGAAATATATATTCGTTGGCGGCAATCGGAGATATGTTGTACACCGGATCTGATAGCAAGAACATTCGCGTTTGGAAGAACCGCAAGGAATTTTCTGGATTCAAATCTAACAGCGGATTAGTTAAAGCGATTGTGAT...

Protein

Download Protein FASTA

407 aa · LXL04_024273|LXL04_024273|OH1004|PROTEIN

MNSTPSSPVASSKWSYREQAAPNCTDFSDYTGLLASLVREEGNIYSLAAIGDMLYTGSDSKNIRVWKNRKEFSGFKSNSGLVKAIVIADDKIFTGHSDGKIRVWKVSAKNPRVHKKIGTLPNLTSIVEKSMKPKNYTEVRNNHSAIWIKHYDAISSLSLTEDRSLLYSGSWDKTIKVWKVSDFKCLESIPAHDDAVNAVAAGFDDLIFSGSADGTVKMWRREIPGKRTKHYLLYTLLKQESAVTSLVVNPAGTVVYAGLS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024273`
TK1151 ID	TkA06G157480
OH-1004 ID	LXL04_024273
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	88.000
Protein coverage (%)	TK1151 99.722 / OH-1004 98.280 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024273

Location Chr05:86296311-86297534 (-)

Description Similar to JGB: Protein JINGUBANG

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g26490`	Negative regulator of pollen germination.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024273 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009846 pollen germination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ana:alr3466

ath:AT2G26490

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.454

Rank 1 · LXL04_024273 · OH-1004

Cytoplasm0.408

Rank 2 · LXL04_024273 · OH-1004

Cell membrane0.135

Rank 3 · LXL04_024273 · OH-1004

Lysosome / Vacuole0.053

Rank 4 · LXL04_024273 · OH-1004

Endoplasmic reticulum0.047

Rank 5 · LXL04_024273 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24017.3Beta-prop_SCAP31-270 aa

PF25171.2Beta-prop_WDR36-Utp21_1st40-136 aa

PF24807.2WD40_CDC20-Fz44-220 aa

PF25174.2Beta-prop_THOC350-219 aa

PF24796.2WDR55135-332 aa

PF24817.2WD40_WDHD1_1st140-221 aa

PF25391.2WD40_Gbeta145-308 aa

PF25047.1Beta-prop_TEP1_2nd148-221 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024273	`PF24017.3`	Beta-prop_SCAP	31	270	5.5e-21	75.7
LXL04_024273	`PF25171.2`	Beta-prop_WDR36-Utp21_1st	40	136	8.5e-11	42.5
LXL04_024273	`PF24807.2`	WD40_CDC20-Fz	44	220	1.6e-23	84.2
LXL04_024273	`PF25174.2`	Beta-prop_THOC3	50	219	2.5e-29	102.9
LXL04_024273	`PF24796.2`	WDR55	135	332	1.4e-17	64.4
LXL04_024273	`PF24817.2`	WD40_WDHD1_1st	140	221	2.2e-23	83.6
LXL04_024273	`PF25391.2`	WD40_Gbeta	145	308	8.1e-13	48.8
LXL04_024273	`PF25047.1`	Beta-prop_TEP1_2nd	148	221	8.4e-23	81.5
LXL04_024273	`PF00400.39`	WD40	149	178	3.5e-40	135.4
LXL04_024273	`PF20426.5`	NBCH_WD40	149	185	4.9e-11	42.8
LXL04_024273	`PF25173.2`	Beta-prop_WDR3_1st	150	220	3.5e-35	122.1
LXL04_024273	`PF25175.2`	Beta-prop_WDR5	150	268	1.3e-32	114.0
LXL04_024273	`PF25174.2`	Beta-prop_THOC3	150	272	2.5e-29	102.9
LXL04_024273	`PF24814.2`	WD40_Prp19	153	270	1.6e-27	97.0
LXL04_024273	`PF23409.2`	Beta-prop_EML	153	334	1.1e-13	52.1
LXL04_024273	`PF23381.2`	Beta-prop_IFT122_1st	154	270	2.2e-28	100.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O48716`	Arabidopsis thaliana	Protein JINGUBANG	60.000%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card