LXL04_024084 | RubberDandelionOmics

Gene overview

LXL04_024084

Reference: OH-1004 Chr: Chr05 Coordinates: 80739674-80746651 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3750 bp · LXL04_024084|LXL04_024084|OH1004|cDNA

ATGGGGAAAGTGATGGATAACACCGGCGAGTTCATGTCTACCGATCCCAAGTCAACCCCAGGGAAGAAACCACCATCAACTCCAAGGCTTTTCATCAAAGAAATGGTTATGCAGAATTTCAAATCTTACGCTGGTGCACAGCGCGTTGGACCCTTTCATAAGAGCTTTACCGCTGTTGTCGGTCCTAATGGTAGCGGGAAGAGTAATGTTATTGATGCCATGTTGTTCGTATTTGGAAAGCGAGCTAAGCAGATGCGTCT...

CDS

Download CDS FASTA

3750 bp · LXL04_024084|LXL04_024084|OH1004|CDS

ATGGGGAAAGTGATGGATAACACCGGCGAGTTCATGTCTACCGATCCCAAGTCAACCCCAGGGAAGAAACCACCATCAACTCCAAGGCTTTTCATCAAAGAAATGGTTATGCAGAATTTCAAATCTTACGCTGGTGCACAGCGCGTTGGACCCTTTCATAAGAGCTTTACCGCTGTTGTCGGTCCTAATGGTAGCGGGAAGAGTAATGTTATTGATGCCATGTTGTTCGTATTTGGAAAGCGAGCTAAGCAGATGCGTCT...

Protein

Download Protein FASTA

1249 aa · LXL04_024084|LXL04_024084|OH1004|PROTEIN

MGKVMDNTGEFMSTDPKSTPGKKPPSTPRLFIKEMVMQNFKSYAGAQRVGPFHKSFTAVVGPNGSGKSNVIDAMLFVFGKRAKQMRLNKVSELIHNSTNHQNLNSARVSVHFQEIIDLDDDTYEAVPGSDFVIAREAFRDNSSKYYINGRDSKFTEVTKKLKGKGVDLDNNRFLILQGEVEQISLMKPKAQGPHDEGFLEYLEDIIGTNKYLEKIEESHKQLEALNEKRSGVVQMVKLADKERENLESVKNEAEDYMLKE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024084`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024084

Location Chr05:80739674-80746651 (+)

Description Similar to SMC4: Structural maintenance of chromosomes protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g48600`	Central component of the condensin complex, a complex required for conversion of interphase chromatin into mitotic-like condense chromosomes.	Disruption of the Arabidopsis SMC4 gene, AtCAP-C, compromises gametogenesis and embryogenesis.2006 · DOI: 10.1007/s00425-006-0234-z

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024084 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000012 single strand break repair Biological Process

GO:0000070 mitotic sister chromatid segregation Biological Process

GO:0007059 chromosome segregation Biological Process

GO:0007076 mitotic chromosome condensation Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010032 meiotic chromosome condensation Biological Process

GO:0045132 meiotic chromosome segregation Biological Process

GO:0048468 cell development Biological Process

GO:0051301 cell division Biological Process

GO:0051321 meiotic cell cycle Biological Process

GO:0051383 kinetochore organization Biological Process

GO:0051984 positive regulation of chromosome segregation Biological Process

KEGG gene cross-reference

ath:AT5G48600

ddi:DDB_G0286403

hsa:10051

mmu:70099

xla:397799

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.691

Rank 1 · LXL04_024084 · OH-1004

Cytoplasm0.323

Rank 2 · LXL04_024084 · OH-1004

Mitochondrion0.036

Rank 3 · LXL04_024084 · OH-1004

Cell membrane0.036

Rank 4 · LXL04_024084 · OH-1004

Golgi apparatus0.025

Rank 5 · LXL04_024084 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02463.26SMC_N31-1233 aa

PF13555.13AAA_2933-91 aa

PF13476.13AAA_2335-255 aa

PF13304.13AAA_2156-124 aa

PF06470.19SMC_hinge561-677 aa

PF24161.2CCDC39722-846 aa

PF24627.2PUMA_CC733-797 aa

PF24161.2CCDC39849-1110 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024084	`PF02463.26`	SMC_N	31	1233	3.1e-55	187.7
LXL04_024084	`PF13555.13`	AAA_29	33	91	2.7e-07	30.9
LXL04_024084	`PF13476.13`	AAA_23	35	255	1.5e-12	49.3
LXL04_024084	`PF13304.13`	AAA_21	56	124	2.6e-11	44.7
LXL04_024084	`PF06470.19`	SMC_hinge	561	677	1.7e-23	83.9
LXL04_024084	`PF24161.2`	CCDC39	722	846	9e-06	24.6
LXL04_024084	`PF24627.2`	PUMA_CC	733	797	2.4e-06	28.2
LXL04_024084	`PF24161.2`	CCDC39	849	1110	9e-06	24.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FJL0`	Arabidopsis thaliana	Structural maintenance of chromosomes protein 4	71.487%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card