LXL04_024043 | RubberDandelionOmics

Gene overview

LXL04_024043

Reference: OH-1004 Chr: Chr05 Coordinates: 78552603-78555492 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1056 bp · LXL04_024043|LXL04_024043|OH1004|cDNA

ATGTACGGATTCGAAGCTATGACCTTCAACATTCACGGGGGTTACCTCGAAGCGATCGTCAGGGGCCACAGATCTGGTTTATTGACCGCGGCTGATTACAACAATCTCTGTCAGTGTGAAACTCTTGATGACATCAAGATGCATCTCTCTGCCACCGAATACGGTCCTTATCTTCAAAACGAGCCATCACCATTGCATACAACTACAATTGTAGAGAAATGCACCCTGAAGTTGGTTGATGAGTATAAGCACATGTTATG...

CDS

Download CDS FASTA

1056 bp · LXL04_024043|LXL04_024043|OH1004|CDS

ATGTACGGATTCGAAGCTATGACCTTCAACATTCACGGGGGTTACCTCGAAGCGATCGTCAGGGGCCACAGATCTGGTTTATTGACCGCGGCTGATTACAACAATCTCTGTCAGTGTGAAACTCTTGATGACATCAAGATGCATCTCTCTGCCACCGAATACGGTCCTTATCTTCAAAACGAGCCATCACCATTGCATACAACTACAATTGTAGAGAAATGCACCCTGAAGTTGGTTGATGAGTATAAGCACATGTTATG...

Protein

Download Protein FASTA

351 aa · LXL04_024043|LXL04_024043|OH1004|PROTEIN

MYGFEAMTFNIHGGYLEAIVRGHRSGLLTAADYNNLCQCETLDDIKMHLSATEYGPYLQNEPSPLHTTTIVEKCTLKLVDEYKHMLCQATEPMSTFLEYITYGHMIDNVVLIVTGTLHERDVQELLEKCHPLGMFDSIATLAVAQNMRELYRLVLVDTPLAPYFSECITSEDLDDMNIEIMRNTLYKAYLEDFYRFCQKLGGATAEIMSDLLAFEADRRAVNITINSIGTELTREDRRKLYSSFGLLYPYGHEELAICED...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024043`
TK1151 ID	TkA06G185190
OH-1004 ID	LXL04_024043
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024043

Location Chr05:78552603-78555492 (+)

Description Similar to VHA-d2: V-type proton ATPase subunit d2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g28715`	Subunit of the integral membrane V0 complex of vacuolar ATPase.	No verified direct reference in this release
`At3g28710`	Subunit of the integral membrane V0 complex of vacuolar ATPase.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0587000`	Subunit of the integral membrane V0 complex of vacuolar ATPase.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024043 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006879 intracellular iron ion homeostasis Biological Process

GO:0007034 vacuolar transport Biological Process

GO:0007035 vacuolar acidification Biological Process

GO:0036295 cellular response to increased oxygen levels Biological Process

GO:1902600 proton transmembrane transport Biological Process

GO:0000220 vacuolar proton-transporting V-type ATPase, V0 domain Cellular Component

GO:0000325 plant-type vacuole Cellular Component

GO:0005765 lysosomal membrane Cellular Component

GO:0005769 early endosome Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005774 vacuolar membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

KEGG gene cross-reference

ath:AT3G28710

ath:AT3G28715

ddi:DDB_G0273071

ddi:DDB_G0273657

dme:Dmel_CG2934

dosa:Os01g0587000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.747

Rank 1 · LXL04_024043 · OH-1004

Nucleus0.265

Rank 2 · LXL04_024043 · OH-1004

Cell membrane0.111

Rank 3 · LXL04_024043 · OH-1004

Lysosome / Vacuole0.066

Rank 4 · LXL04_024043 · OH-1004

Mitochondrion0.051

Rank 5 · LXL04_024043 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01992.22vATP-synt_AC3916-344 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024043	`PF01992.22`	vATP-synt_AC39	16	344	1.8e-108	363.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LHA4`	Arabidopsis thaliana	V-type proton ATPase subunit d2	94.302%	Swiss-Prot	strong database homology
`Q9LJI5`	Arabidopsis thaliana	V-type proton ATPase subunit d1	94.017%	Swiss-Prot	strong database homology
`Q8RU33`	Oryza sativa subsp. japonica	Probable V-type proton ATPase subunit d	91.453%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card