LXL04_023827 | RubberDandelionOmics

Gene overview

LXL04_023827

Reference: OH-1004 Chr: Chr05 Coordinates: 70196777-70197766 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

990 bp · LXL04_023827|LXL04_023827|OH1004|cDNA

ATGCCTTCTATCCCTGAAGAGCCTCTTCTTGCTCCAAACCCAGATCGATTCTGTATGTTCCCAATTCAGTACCCTCAAATTTGGGAAATGTACAAGAAAGCCGAAGCTTCCTTTTGGACCGCCGAAGAGGTCGATTTATCTGAGGATCAACGTCACTGGGACTCGTTAACAGACGGCGAGAGGCACTTTATCACCCATGTCCTTGCTTTCTTCGCCGCCTCAGATGGCATCGTTTTGGAAAACCTAGCCGGACGCTTCAT...

CDS

Download CDS FASTA

990 bp · LXL04_023827|LXL04_023827|OH1004|CDS

ATGCCTTCTATCCCTGAAGAGCCTCTTCTTGCTCCAAACCCAGATCGATTCTGTATGTTCCCAATTCAGTACCCTCAAATTTGGGAAATGTACAAGAAAGCCGAAGCTTCCTTTTGGACCGCCGAAGAGGTCGATTTATCTGAGGATCAACGTCACTGGGACTCGTTAACAGACGGCGAGAGGCACTTTATCACCCATGTCCTTGCTTTCTTCGCCGCCTCAGATGGCATCGTTTTGGAAAACCTAGCCGGACGCTTCAT...

Protein

Download Protein FASTA

329 aa · LXL04_023827|LXL04_023827|OH1004|PROTEIN

MPSIPEEPLLAPNPDRFCMFPIQYPQIWEMYKKAEASFWTAEEVDLSEDQRHWDSLTDGERHFITHVLAFFAASDGIVLENLAGRFMKEVQVAEARAFYGFQIAIENIHSEMYSLLLESYIKDSNEKNRLFRAIETIPCVEKKANWALKWIDGSETFAERIIAFACVEGIFFSGSFCAIFWLKKRGLMPGLTFSNELISRDEGLHCDFACLLYGLLKTKLSEERVKGIISDAVAIEREFVCDALPCALVGMNGDLMSKYI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023827`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023827

Location Chr05:70196777-70197766 (-)

Description Similar to Ribonucleoside-diphosphate reductase small chain

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g27060`	Provides the precursors necessary for DNA synthesis.	Arabidopsis ribonucleotide reductases are critical for cell cycle progression, DNA damage repair, and plant development.2006 · DOI: 10.1105/tpc.105.037044
`UniProt: P0DKH3`	Provides the precursors necessary for DNA synthesis.	No verified direct reference in this release
`At3g23580`	Provides the precursors necessary for DNA synthesis.	Arabidopsis ribonucleotide reductases are critical for cell cycle progression, DNA damage repair, and plant development.2006 · DOI: 10.1105/tpc.105.037044

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023827 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006260 DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0009259 ribonucleotide metabolic process Biological Process

GO:0009263 deoxyribonucleotide biosynthetic process Biological Process

GO:0012501 programmed cell death Biological Process

GO:0051726 regulation of cell cycle Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005971 ribonucleoside-diphosphate reductase complex Cellular Component

GO:0004748 ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT3G23580

ath:AT3G27060

nta:107781035

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.664

Rank 1 · LXL04_023827 · OH-1004

Nucleus0.577

Rank 2 · LXL04_023827 · OH-1004

Mitochondrion0.055

Rank 3 · LXL04_023827 · OH-1004

Cell membrane0.044

Rank 4 · LXL04_023827 · OH-1004

Endoplasmic reticulum0.037

Rank 5 · LXL04_023827 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00268.28Ribonuc_red_sm16-282 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023827	`PF00268.28`	Ribonuc_red_sm	16	282	7.5e-114	380.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LSD0`	Arabidopsis thaliana	Ribonucleoside-diphosphate reductase small chain C	85.843%	Swiss-Prot	strong database homology
`P0DKH3`	Arabidopsis thaliana	Ribonucleoside-diphosphate reductase small chain B	80.781%	Swiss-Prot	strong database homology
`P50651`	Arabidopsis thaliana	Ribonucleoside-diphosphate reductase small chain A	73.765%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card