LXL04_023567 | RubberDandelionOmics

Gene overview

LXL04_023567

Reference: OH-1004 Chr: Chr05 Coordinates: 50924329-50930202 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3087 bp · LXL04_023567|LXL04_023567|OH1004|cDNA

ATGGAGTTACAAAACCAGGTGGCGCAGGCGGTTCACGTCCTGAATCACGATGCCCAATCTTGCAATCGCGTCTCTGCTAATCAGTGGCTGGTTCAGTTCCAGCAGACTGATGCTGCTTGGGAGATCGCCACCTCAATTCTGACCTCTGACCATCATAAACAATACCTGTCCGACTTCGAAGTTGAGTTCTTCGCTGCTCAAGTTCTTAAGCGAAAGATCCAAAATGAAGCCCATTGTCTTCAACTGGAAGCAAAAGAATC...

CDS

Download CDS FASTA

3087 bp · LXL04_023567|LXL04_023567|OH1004|CDS

ATGGAGTTACAAAACCAGGTGGCGCAGGCGGTTCACGTCCTGAATCACGATGCCCAATCTTGCAATCGCGTCTCTGCTAATCAGTGGCTGGTTCAGTTCCAGCAGACTGATGCTGCTTGGGAGATCGCCACCTCAATTCTGACCTCTGACCATCATAAACAATACCTGTCCGACTTCGAAGTTGAGTTCTTCGCTGCTCAAGTTCTTAAGCGAAAGATCCAAAATGAAGCCCATTGTCTTCAACTGGAAGCAAAAGAATC...

Protein

Download Protein FASTA

1028 aa · LXL04_023567|LXL04_023567|OH1004|PROTEIN

MELQNQVAQAVHVLNHDAQSCNRVSANQWLVQFQQTDAAWEIATSILTSDHHKQYLSDFEVEFFAAQVLKRKIQNEAHCLQLEAKESLVNALLVAAKKFSLGPPQLLTQICLALSTLILHAVDYNKPIEKLFYSLQNLRGQNDGNIAVLEMLRVLPEVVEDECATYNIKSGQRADYGPELLSHTSSVLEFLLQQSNESFDGVIQSHDRTRKILRCLLSWIRAGCFSEMLPGSLLSHPLLNFVFNSVQNLSSFDLAIEVLI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023567`
TK1151 ID	TkA06G274240
OH-1004 ID	LXL04_023567
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023567

Location Chr05:50924329-50930202 (+)

Description Similar to MOS14: Transportin MOS14

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g62600`	Functions as a nuclear import receptor for serine-arginine rich (SR) proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023567 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006403 RNA localization Biological Process

GO:0006404 RNA import into nucleus Biological Process

GO:0006606 protein import into nucleus Biological Process

GO:0035719 tRNA import into nucleus Biological Process

GO:0043484 regulation of RNA splicing Biological Process

GO:0051031 tRNA transport Biological Process

GO:0061015 snRNA import into nucleus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005642 annulate lamellae Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT5G62600

hsa:23534

mmu:320938

sce:YOR160W

spo:2539916

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.724

Rank 1 · LXL04_023567 · OH-1004

Cytoplasm0.368

Rank 2 · LXL04_023567 · OH-1004

Cell membrane0.046

Rank 3 · LXL04_023567 · OH-1004

Lysosome / Vacuole0.036

Rank 4 · LXL04_023567 · OH-1004

Endoplasmic reticulum0.034

Rank 5 · LXL04_023567 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08389.19Xpo1103-259 aa

PF24138.2TPR_TNPO3_IPO13_2nd314-408 aa

PF24139.2TPR_TNPO3_IPO13_4th696-792 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023567	`PF08389.19`	Xpo1	103	259	1.3e-14	55.3
LXL04_023567	`PF24138.2`	TPR_TNPO3_IPO13_2nd	314	408	9.5e-10	39.4
LXL04_023567	`PF24139.2`	TPR_TNPO3_IPO13_4th	696	792	8.9e-09	36.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GUL2`	Arabidopsis thaliana	Transportin MOS14	23.047%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card