LXL04_023546 | RubberDandelionOmics

Gene overview

LXL04_023546

Reference: OH-1004 Chr: Chr05 Coordinates: 49389733-49394381 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1353 bp · LXL04_023546|LXL04_023546|OH1004|cDNA

ATGTTAGAAGCCTTGCTTCACTTGATCGAAGCCTTGGATCTCGAAGATTATGAAGATCCAAGAAATGTATGGTGTAGAAAGGTGGTGACAAGGAGCTTTGTAGATGGTGATGAGATGGTGATTTACGTGAGAAGGGAGAGGGAAAGAGAAGGTGTAGGGGGCTGGTCATCACTTGCTTGGTTCAAGGGTGATCAAGATGGGATGTGGCTCGAAATGGGGGAAGGGAAAGGAAAAGGGCTGGTCATCTTGGCTAGTTATAG...

CDS

Download CDS FASTA

1353 bp · LXL04_023546|LXL04_023546|OH1004|CDS

ATGTTAGAAGCCTTGCTTCACTTGATCGAAGCCTTGGATCTCGAAGATTATGAAGATCCAAGAAATGTATGGTGTAGAAAGGTGGTGACAAGGAGCTTTGTAGATGGTGATGAGATGGTGATTTACGTGAGAAGGGAGAGGGAAAGAGAAGGTGTAGGGGGCTGGTCATCACTTGCTTGGTTCAAGGGTGATCAAGATGGGATGTGGCTCGAAATGGGGGAAGGGAAAGGAAAAGGGCTGGTCATCTTGGCTAGTTATAG...

Protein

Download Protein FASTA

450 aa · LXL04_023546|LXL04_023546|OH1004|PROTEIN

MLEALLHLIEALDLEDYEDPRNVWCRKVVTRSFVDGDEMVIYVRREREREGVGGWSSLAWFKGDQDGMWLEMGEGKGKGLVILASYRFLDICVKCYYGKTLIWGEMEWQDARNRWGYHHRNFWRRYSLHLRLSIWLLSISLLSTFDSGETESLRLLSLHDNKYLRYFKGHHEFMTGMVSLAVSLSQCAPTDCFILGSLDRIVILWIKVLINARFSDFICRVCNLEFFSFSCFNNLDSQCFLIETISGSKETHSISSSIAD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023546`
TK1151 ID	TkA06G255330
OH-1004 ID	LXL04_023546
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 57.561 / OH-1004 26.222 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023546

Location Chr05:49389733-49394381 (+)

Description Similar to PDR2: Pleiotropic drug resistance protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0384500`	May be a general defense protein.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023546 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009914 hormone transport Biological Process

GO:2000032 regulation of secondary shoot formation Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0140359 ABC-type transporter activity Molecular Function

KEGG gene cross-reference

dosa:Os08g0384500

nta:107799533

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.303

Rank 1 · LXL04_023546 · OH-1004

Cytoplasm0.283

Rank 2 · LXL04_023546 · OH-1004

Cell membrane0.199

Rank 3 · LXL04_023546 · OH-1004

Endoplasmic reticulum0.199

Rank 4 · LXL04_023546 · OH-1004

Mitochondrion0.116

Rank 5 · LXL04_023546 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01061.30ABC2_membrane310-367 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023546	`PF01061.30`	ABC2_membrane	310	367	6.8e-11	42.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6YW62`	Oryza sativa subsp. japonica	ABC transporter G family member 44	67.188%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card