LXL04_023265 | RubberDandelionOmics

Gene overview

LXL04_023265

Reference: OH-1004 Chr: Chr05 Coordinates: 29248674-29251723 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1538 bp · LXL04_023265|LXL04_023265|OH1004|cDNA

ATGCATCCCCGACACGTGATCGTACTTGGTAAAGCTCAGACGACGGCACGTGGATTGGCTATGTCAGCTTCGATTCCCTTCATCATTATTATTTGCAGTCCAACTTGCAAAATCCCTAATTCTCATTATCCCTTGCTTCACGTCACACTTCCTCCACGAAACGCACATTCTGCTCTTCGATTATATATACttacagagagagagagagagaggaaaaAATGACGGATATAGTGGTTGACGGTGACGTTGacggtggtggc...

CDS

Download CDS FASTA

1320 bp · LXL04_023265|LXL04_023265|OH1004|CDS

ATGACGGATATAGTGGTTGACGGTGACGTTGACGGTGGTGGCGGTGGTGATTGGTCGCCGATGAAGGATGGTATTGAAGTCGATGGTGCTCGTGAGCCGACGGTGAGAAGAACTGATGCAGAGAGTTTGAGAGATATGCAGTTATCGATAGCGGCGTCGTCTTCGGTGTTTCCAGGGTTTCGATTCTCGCCGACGGACGATGAGTTGATTTCGTATTACTTGAAGAAGAAGCTCCAAGGATCCGACCAATGTGTTGATAT...

Protein

Download Protein FASTA

439 aa · LXL04_023265|LXL04_023265|OH1004|PROTEIN

MTDIVVDGDVDGGGGGDWSPMKDGIEVDGAREPTVRRTDAESLRDMQLSIAASSSVFPGFRFSPTDDELISYYLKKKLQGSDQCVDIIPEVDFCRHEPWDLPALSIIRSDNEWFFFSTRGKKYPNGSQSKRATQSGYWKATGKERNVKSGSVTIGTKRTLVFHTGRAPKGERTEWIMHEYCMTDSTQESLVVCRLRRNGEFRLTESSRGSSDHRTENDHHSGTNEYANNAPVDGFDEANALKSTSKDSTSSYRSHSVEQN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023265`
TK1151 ID	TkA06G377200
OH-1004 ID	LXL04_023265
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 84.749 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023265

Location Chr05:29248674-29251723 (-)

Description Similar to NTL8: NAC domain-containing protein 40

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g27300`	Transcriptional activator activated by proteolytic cleavage through regulated intramembrane proteolysis (RIP), probably via metalloprotease activity.	A membrane-associated NAC transcription factor regulates salt-responsive flowering via FLOWERING LOCUS T in Arabidopsis.2007 · DOI: 10.1007/s00425-007-0513-3 A membrane-bound NAC transcription factor NTL8 regulates gibberellic acid-mediated salt signaling in Arabidopsis seed germination.2008 · DOI: 10.1111/j.1365-313x.2008.03493.x Membrane-mediated salt stress signaling in flowering time control.2007 · DOI: 10.4161/psb.2.6.4645
`At3g44290`	Transcriptional activator activated by proteolytic cleavage through regulated intramembrane proteolysis (RIP) (By similarity).	No verified direct reference in this release
`At5g22290`	Transcription factor involved in plant cell division.	No verified direct reference in this release
`At4g35580`	Transcriptional activator activated by proteolytic cleavage through regulated intramembrane proteolysis (RIP).	Identification of a calmodulin-binding NAC protein as a transcriptional repressor in Arabidopsis.2007 · DOI: 10.1074/jbc.m705217200 Regulation of leaf senescence by NTL9-mediated osmotic stress signaling in Arabidopsis.2008 · PMID: 18443413 A NAC transcription factor and SNI1 cooperatively suppress basal pathogen resistance in Arabidopsis thaliana.2012 · DOI: 10.1093/nar/gks683 The Pseudomonas syringae type III effector HopD1 suppresses effector-triggered immunity, localizes to the endoplasmic reticulum, and targets the Arabidopsis transcription factor NTL9.2014 · DOI: 10.1111/nph.12626

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0261200`	Transcription activator involved in heat and endoplasmic reticulum (ER) stress responses.	A membrane-associated NAC transcription factor OsNTL3 is involved in thermotolerance in rice.2020 · DOI: 10.1111/pbi.13297

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023265 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006986 response to unfolded protein Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0009740 gibberellic acid mediated signaling pathway Biological Process

GO:0009845 seed germination Biological Process

GO:0009908 flower development Biological Process

GO:0009910 negative regulation of flower development Biological Process

GO:0009938 negative regulation of gibberellic acid mediated signaling pathway Biological Process

GO:0031347 regulation of defense response Biological Process

KEGG gene cross-reference

ath:AT2G27300

ath:AT3G44290

ath:AT4G35580

ath:AT5G22290

dosa:Os01g0261200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.841

Rank 1 · LXL04_023265 · OH-1004

Cytoplasm0.161

Rank 2 · LXL04_023265 · OH-1004

Cell membrane0.108

Rank 3 · LXL04_023265 · OH-1004

Endoplasmic reticulum0.083

Rank 4 · LXL04_023265 · OH-1004

Plastid0.020

Rank 5 · LXL04_023265 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02365.21NAM58-181 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023265	`PF02365.21`	NAM	58	181	7.1e-46	156.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XIN7`	Arabidopsis thaliana	NAC domain-containing protein 40	48.699%	Swiss-Prot	moderate database homology
`Q9LXL9`	Arabidopsis thaliana	NAC domain-containing protein 60	49.407%	Swiss-Prot	moderate database homology
`Q94F58`	Arabidopsis thaliana	NAC domain-containing protein 89	50.394%	Swiss-Prot	moderate database homology
`F4JN35`	Arabidopsis thaliana	Protein NTM1-like 9	57.792%	Swiss-Prot	weak database homology
`Q7GCL7`	Oryza sativa subsp. japonica	NAC domain-containing protein 74	52.663%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card