LXL04_023260 | RubberDandelionOmics

Gene overview

LXL04_023260

Reference: OH-1004 Chr: Chr05 Coordinates: 29119491-29121967 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

972 bp · LXL04_023260|LXL04_023260|OH1004|cDNA

ATGAACAAATTGTTACAATCGACTATCGTAACTCATCTTACATCACGATTGACGGTGTTTTCCGGCAGAAATAACAGCAAATTCGCCATGACCACCACGTCGGAGGCTGTTGGGTTCAGTGCGCCGAGATTGGTGACGAAGAAGGTTTTGGCGAAGAGACAGAGCGAAGGAGATGGTGCTGTTGTTCGGAGAAGCATCGGAAGGCCGGAGTTGAAGTCTCTGGATCCATTCCTCATGTTAGACGAattttctgTTTCTGC...

CDS

Download CDS FASTA

972 bp · LXL04_023260|LXL04_023260|OH1004|CDS

ATGAACAAATTGTTACAATCGACTATCGTAACTCATCTTACATCACGATTGACGGTGTTTTCCGGCAGAAATAACAGCAAATTCGCCATGACCACCACGTCGGAGGCTGTTGGGTTCAGTGCGCCGAGATTGGTGACGAAGAAGGTTTTGGCGAAGAGACAGAGCGAAGGAGATGGTGCTGTTGTTCGGAGAAGCATCGGAAGGCCGGAGTTGAAGTCTCTGGATCCATTCCTCATGTTAGACGAATTTTCTGTTTCTGC...

Protein

Download Protein FASTA

323 aa · LXL04_023260|LXL04_023260|OH1004|PROTEIN

MNKLLQSTIVTHLTSRLTVFSGRNNSKFAMTTTSEAVGFSAPRLVTKKVLAKRQSEGDGAVVRRSIGRPELKSLDPFLMLDEFSVSAPAGFPDHPHRGFETVTYMLEGAFTHQDFSGHKGTIRAGDVQWMTAGRGIIHSEMPAATGVQKGLQLWINLSSKDKMVEPNYQELLREDIQTVERDGVKVTIIAGESMGVKSPVYTRTPTMFLDFTLDPGSQTHQPVPESWNSFVYVIEGEGVFGSMDSKPVLAHHVLVLSQGD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023260`
TK1151 ID	TkA06G377070
OH-1004 ID	LXL04_023260
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023260

Location Chr05:29119491-29121967 (-)

Description Similar to Pirin-like protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g43120`	Involved in susceptibility to the bacterial plant pathogen Ralstonia solanacearum.	PIRIN2 stabilizes cysteine protease XCP2 and increases susceptibility to the vascular pathogen Ralstonia solanacearum in Arabidopsis.2014 · DOI: 10.1111/tpj.12602
`At3g59220`	Involved in abscisic acid signal transduction.	The GCR1, GPA1, PRN1, NF-Y signal chain mediates both blue light and abscisic acid responses in Arabidopsis.2007 · DOI: 10.1104/pp.106.089904
`At1g50590`	Pirin-like protein At1g50590.	No verified direct reference in this release
`At3g59260`	Putative pirin-like protein At3g59260.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023260 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009785 blue light signaling pathway Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0030414 peptidase inhibitor activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G50590

ath:AT2G43120

ath:AT3G59220

ath:AT3G59260

sly:543607

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.367

Rank 1 · LXL04_023260 · OH-1004

Cytoplasm0.316

Rank 2 · LXL04_023260 · OH-1004

Peroxisome0.198

Rank 3 · LXL04_023260 · OH-1004

Nucleus0.124

Rank 4 · LXL04_023260 · OH-1004

Plastid0.123

Rank 5 · LXL04_023260 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02678.23Pirin62-155 aa

PF05726.20Pirin_C209-312 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023260	`PF02678.23`	Pirin	62	155	1.8e-33	115.5
LXL04_023260	`PF05726.20`	Pirin_C	209	312	4e-35	121.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZW82`	Arabidopsis thaliana	Pirin-like protein 2	69.608%	Swiss-Prot	strong database homology
`Q9LX49`	Arabidopsis thaliana	Pirin-1	66.192%	Swiss-Prot	strong database homology
`Q9LPS9`	Arabidopsis thaliana	Pirin-like protein At1g50590	61.333%	Swiss-Prot	strong database homology
`Q9LX45`	Arabidopsis thaliana	Putative pirin-like protein At3g59260	64.259%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card