LXL04_023227 | RubberDandelionOmics

Gene overview

LXL04_023227

Reference: OH-1004 Chr: Chr05 Coordinates: 27728602-27734750 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2073 bp · LXL04_023227|LXL04_023227|OH1004|cDNA

ATGTCAGAGGACGTGCTTCTACACCTGGCCTCAAACTCCTCTAATCAATCCGATCAATCTCTGCCATCAAAAATTGCAAAACTCGAAGCCAGAATGGTGGGTAAAACCTCCACTGCGGTGGTGTCTACTCTTCAGCTTCCATCTGCCCAAGCCACAGCAACCCGGTCCTCCATTtctgcttcttcagcttccAAGTTTGGAGCTAATGCTGCTGGTGAGATTTGTGCTGAATCCTTGGACTCTAGCGATTCGGAAGAGGA...

CDS

Download CDS FASTA

2073 bp · LXL04_023227|LXL04_023227|OH1004|CDS

ATGTCAGAGGACGTGCTTCTACACCTGGCCTCAAACTCCTCTAATCAATCCGATCAATCTCTGCCATCAAAAATTGCAAAACTCGAAGCCAGAATGGTGGGTAAAACCTCCACTGCGGTGGTGTCTACTCTTCAGCTTCCATCTGCCCAAGCCACAGCAACCCGGTCCTCCATTTCTGCTTCTTCAGCTTCCAAGTTTGGAGCTAATGCTGCTGGTGAGATTTGTGCTGAATCCTTGGACTCTAGCGATTCGGAAGAGGA...

Protein

Download Protein FASTA

690 aa · LXL04_023227|LXL04_023227|OH1004|PROTEIN

MSEDVLLHLASNSSNQSDQSLPSKIAKLEARMVGKTSTAVVSTLQLPSAQATATRSSISASSASKFGANAAGEICAESLDSSDSEEDDSNGREFLIQANFQKRRKLADDADSNSAEQNKVAVDVRQENVETLEAKSGTNVNKRKQSRGKSNSTPARGRGSSNDQTRTQNSTSTPPSLNGLFENSHQKQNSRPKEQLGQNERALLEEEVTSLRVKITTLEEDLKKARQEASEYQHMCQQLEKELKELKSTEQQVKPKRMKV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023227`
TK1151 ID	TkA06G386730
OH-1004 ID	LXL04_023227
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023227

Location Chr05:27728602-27734750 (+)

Description Similar to TOUSLED: Serine/threonine-protein kinase TOUSLED

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g20930`	Required for correct initiation of floral organ primordia and for proper development of organ primordia.	TOUSLED kinase activity oscillates during the cell cycle and interacts with chromatin regulators.2004 · DOI: 10.1104/pp.103.038117 The Tousled gene in A. thaliana encodes a protein kinase homolog that is required for leaf and flower development.1993 · DOI: 10.1016/0092-8674(93)90537-z

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023227 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006325 chromatin organization Biological Process

GO:0006468 protein phosphorylation Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0006974 DNA damage response Biological Process

GO:0007059 chromosome segregation Biological Process

GO:0007283 spermatogenesis Biological Process

GO:0018105 peptidyl-serine phosphorylation Biological Process

GO:0030154 cell differentiation Biological Process

GO:0032435 negative regulation of proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0051647 nucleus localization Biological Process

GO:0060147 regulation of post-transcriptional gene silencing Biological Process

KEGG gene cross-reference

ath:AT5G20930

dre:407732

hsa:9874

mmu:24086

xtr:780168

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.764

Rank 1 · LXL04_023227 · OH-1004

Cytoplasm0.328

Rank 2 · LXL04_023227 · OH-1004

Cell membrane0.036

Rank 3 · LXL04_023227 · OH-1004

Mitochondrion0.025

Rank 4 · LXL04_023227 · OH-1004

Golgi apparatus0.018

Rank 5 · LXL04_023227 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase412-685 aa

PF07714.24PK_Tyr_Ser-Thr415-681 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023227	`PF00069.32`	Pkinase	412	685	3.2e-58	197.9
LXL04_023227	`PF07714.24`	PK_Tyr_Ser-Thr	415	681	5.8e-32	111.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q39238`	Arabidopsis thaliana	Serine/threonine-protein kinase TOUSLED	65.379%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card