LXL04_023116 | RubberDandelionOmics

Gene overview

LXL04_023116

Reference: OH-1004 Chr: Chr05 Coordinates: 23815616-23817568 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1953 bp · LXL04_023116|LXL04_023116|OH1004|cDNA

ATGTCTCGTCTCTACAATTGCATCCGGGTTTTTCTTTCAAATGAAATACCCAAAAAGCCCTTCGATCTTCATATCAGATATCTCTGCAGTACTATAAACCCAAAAACACTTTCATGGCAAGGATCTTCATCTTCTCATGACATTTTACTCAAAAACCTTGAAACTTCTCTAAAAAACCATCAACTAAATGAAGCATGGGAATCCTACACAGATTTCAAAAAACTTCACGGTTTACCAAACACCCAGTTATTGAACAAATT...

CDS

Download CDS FASTA

1953 bp · LXL04_023116|LXL04_023116|OH1004|CDS

ATGTCTCGTCTCTACAATTGCATCCGGGTTTTTCTTTCAAATGAAATACCCAAAAAGCCCTTCGATCTTCATATCAGATATCTCTGCAGTACTATAAACCCAAAAACACTTTCATGGCAAGGATCTTCATCTTCTCATGACATTTTACTCAAAAACCTTGAAACTTCTCTAAAAAACCATCAACTAAATGAAGCATGGGAATCCTACACAGATTTCAAAAAACTTCACGGTTTACCAAACACCCAGTTATTGAACAAATT...

Protein

Download Protein FASTA

650 aa · LXL04_023116|LXL04_023116|OH1004|PROTEIN

MSRLYNCIRVFLSNEIPKKPFDLHIRYLCSTINPKTLSWQGSSSSHDILLKNLETSLKNHQLNEAWESYTDFKKLHGLPNTQLLNKFISELSYSLTPKWLQKACDITLSLSKEKSNLLHVDQIHNLSLSLARAQMPIPASKILRTMIEKNKIPPNSIFGSITLHMVKSGVGTYLASNILIQICNQLKPDTRIFNLVLDSCSSYNLSFKAQQIIELMAQIGIVGDAYTIINIAKIHAINGQRDDLKKFKNCVDEVAGYLGH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023116`
TK1151 ID	TkA06G398890
OH-1004 ID	LXL04_023116
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.600
Protein coverage (%)	TK1151 100.000 / OH-1004 51.077 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023116

Location Chr05:23815616-23817568 (-)

Description Similar to At4g17616: Pentatricopeptide repeat-containing protein At4g17616

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g17616`	Pentatricopeptide repeat-containing protein At4g17616.	No verified direct reference in this release
`At1g03100`	Pentatricopeptide repeat-containing protein At1g03100, mitochondrial.	No verified direct reference in this release
`At1g69290`	Pentatricopeptide repeat-containing protein At1g69290.	No verified direct reference in this release
`At3g09650`	Involved in the processing of polycistronic chloroplast psbB- psbT-psbH-petB-petD transcript.	The nucleus-encoded HCF107 gene of Arabidopsis provides a link between intercistronic RNA processing and the accumulation of translation-competent psbH transcripts in chloroplasts.2001 · DOI: 10.1105/tpc.010090 HCF152, an Arabidopsis RNA binding pentatricopeptide repeat protein involved in the processing of chloroplast psbB-psbT-psbH-petB-petD RNAs.2003 · DOI: 10.1105/tpc.010397
`At1g68980`	Pentatricopeptide repeat-containing protein At1g68980, mitochondrial.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023116 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0000166 nucleotide binding Molecular Function

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G03100

ath:AT1G68980

ath:AT1G69290

ath:AT3G09650

ath:AT4G17616

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.831

Rank 1 · LXL04_023116 · OH-1004

Plastid0.088

Rank 2 · LXL04_023116 · OH-1004

Nucleus0.058

Rank 3 · LXL04_023116 · OH-1004

Cytoplasm0.037

Rank 4 · LXL04_023116 · OH-1004

Cell membrane0.011

Rank 5 · LXL04_023116 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25245.1TPR_At1g6898049-167 aa

PF23276.3TPR_24393-522 aa

PF13041.13PPR_2499-541 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023116	`PF25245.1`	TPR_At1g68980	49	167	6.9e-11	43.2
LXL04_023116	`PF23276.3`	TPR_24	393	522	2.9e-09	37.6
LXL04_023116	`PF13041.13`	PPR_2	499	541	6.6e-23	81.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B3H672`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At4g17616	43.478%	Swiss-Prot	moderate database homology
`Q9SA60`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g03100, mitochondrial	27.194%	Swiss-Prot	weak database homology
`P0C7R4`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g69290	22.929%	Swiss-Prot	weak database homology
`Q9SF38`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At3g09650, chloroplastic	20.863%	Swiss-Prot	weak database homology
`Q9CAA5`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g68980, mitochondrial	23.433%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card