RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_023110
Reference: OH-1004 Chr: Chr05 Coordinates: 23468248-23473107 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1968 bp · LXL04_023110|LXL04_023110|OH1004|cDNA

ATGGAATCCATTCAAACAATCATCAAAACCCTTCTAAAGAATCCAACACAAATCAAATCAAAATCTCAAGCCAAACAAATCCATGCTCAAATCCTCAAAAGCTTCCCTACATTTACCTCCACTCTCCTCTCAATCTACTCCAAACTCAACCTCTTACCGGAATCCCTCATTCTCTTCAACACACTCCACTCTCCTCCGATCCTCGCTTGGAAGTCCATCATCAAATGCTACACTTCCAATGCCTGTTACTTACAATCCTT...

CDS

Download CDS FASTA

1968 bp · LXL04_023110|LXL04_023110|OH1004|CDS

ATGGAATCCATTCAAACAATCATCAAAACCCTTCTAAAGAATCCAACACAAATCAAATCAAAATCTCAAGCCAAACAAATCCATGCTCAAATCCTCAAAAGCTTCCCTACATTTACCTCCACTCTCCTCTCAATCTACTCCAAACTCAACCTCTTACCGGAATCCCTCATTCTCTTCAACACACTCCACTCTCCTCCGATCCTCGCTTGGAAGTCCATCATCAAATGCTACACTTCCAATGCCTGTTACTTACAATCCTT...

Protein

Download Protein FASTA

655 aa · LXL04_023110|LXL04_023110|OH1004|PROTEIN

MESIQTIIKTLLKNPTQIKSKSQAKQIHAQILKSFPTFTSTLLSIYSKLNLLPESLILFNTLHSPPILAWKSIIKCYTSNACYLQSLNCFLKMRGSGIYPDHNVFPSVLKSCTHLTYFNFGESVHACVIRVGLEFDVFTGNALLSMYSKLQWYTAPQVFDESPERITHLQNPIVFNQMSKVFESMQDPDVVSYNTLILGYTQSNMYNEAMMMIKEMCNINLKSDAFTLSNLLPIVAEFMDIHKGKEIHGYGVRHGFDQNK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_023110
TK1151 IDTkA06G401790
OH-1004 IDLXL04_023110
Relationship / confidenceRbh Sequence Supported / Probable
Protein identity (%)90.000
Protein coverage (%)TK1151 94.336 / OH-1004 88.244
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_023110
LocationChr05:23468248-23473107 (+)
DescriptionSimilar to PCMP-H32: Putative pentatricopeptide repeat-containing protein At3g23330
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g23330 Putative pentatricopeptide repeat-containing protein At3g23330. No verified direct reference in this release
At4g21300 Pentatricopeptide repeat-containing protein At4g21300. No verified direct reference in this release
At1g08070 Involved in multiple sites RNA editing events in chloroplasts. No verified direct reference in this release
At3g22150 Pentatricopeptide repeat-containing protein At3g22150, chloroplastic. No verified direct reference in this release
At4g18750 Plays a major role in single RNA editing events in chloroplasts.
Identification of two pentatricopeptide repeat genes required for RNA editing and zinc binding by C-terminal cytidine deaminase-like domains.2013 · DOI: 10.1074/jbc.m113.485755

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_023110 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0009451 RNA modification Biological Process
GO:0005739 mitochondrion Cellular Component
GO:0003723 RNA binding Molecular Function
GO:0008270 zinc ion binding Molecular Function
KEGG gene cross-reference
ath:AT3G23330
ath:AT4G21300
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.754
Rank 1 · LXL04_023110 · OH-1004
Plastid0.110
Rank 2 · LXL04_023110 · OH-1004
Nucleus0.049
Rank 3 · LXL04_023110 · OH-1004
Cytoplasm0.041
Rank 4 · LXL04_023110 · OH-1004
Cell membrane0.007
Rank 5 · LXL04_023110 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12854.14PPR_1187-216 aa
PF13041.13PPR_2188-232 aa
PF01535.27PPR191-218 aa
PF13041.13PPR_2289-338 aa
PF01535.27PPR292-322 aa
PF13041.13PPR_2391-438 aa
PF01535.27PPR393-423 aa
PF17177.11PPR_long399-515 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_023110PF12854.14PPR_11872163.2e-2381.9
LXL04_023110PF13041.13PPR_21882329.7e-39132.0
LXL04_023110PF01535.27PPR1912182e-38128.7
LXL04_023110PF13041.13PPR_22893389.7e-39132.0
LXL04_023110PF01535.27PPR2923222e-38128.7
LXL04_023110PF13041.13PPR_23914389.7e-39132.0
LXL04_023110PF01535.27PPR3934232e-38128.7
LXL04_023110PF17177.11PPR_long3995152.4e-0937.6
LXL04_023110PF20431.5E_motif5095711.7e-1248.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LW63Arabidopsis thalianaPutative pentatricopeptide repeat-containing protein At3g2333049.246%Swiss-Protmoderate database homology
Q9STE1Arabidopsis thalianaPentatricopeptide repeat-containing protein At4g2130033.868%Swiss-Protmoderate database homology
Q9LN01Arabidopsis thalianaPentatricopeptide repeat-containing protein At1g08070, chloroplastic34.138%Swiss-Protmoderate database homology
Q9LIE7Arabidopsis thalianaPentatricopeptide repeat-containing protein At3g22150, chloroplastic34.191%Swiss-Protmoderate database homology
Q9SN39Arabidopsis thalianaPentatricopeptide repeat-containing protein DOT4, chloroplastic30.243%Swiss-Protmoderate database homology

JBrowse

View in Genome Browser