LXL04_023023 | RubberDandelionOmics

Gene overview

LXL04_023023

Reference: OH-1004 Chr: Chr05 Coordinates: 19169752-19171856 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

838 bp · LXL04_023023|LXL04_023023|OH1004|cDNA

ATGGAAGATCCAAAAAACCGTGCATTTGAGGCAATTGCAAGAAGAGAAGCTCATGCCCTTCAACTACAACAAAAACAGAACAACAATAAGAGAccttttgaaaagaaaacaGTTGAAAGCTCTTCTGATTTTATGTCCACATCTGCTGCAAAGAAAGGAAATTATTCCTTCATAGGGCAAACTGCTAAAAGAGACACAGAAGATCATCCTATATATCTTCCACTCTCTCACCCAGTACATGAGAATCTAGCAATACCAAA...

CDS

Download CDS FASTA

822 bp · LXL04_023023|LXL04_023023|OH1004|CDS

ATGGAAGATCCAAAAAACCGTGCATTTGAGGCAATTGCAAGAAGAGAAGCTCATGCCCTTCAACTACAACAAAAACAGAACAACAATAAGAGACCTTTTGAAAAGAAAACAGTTGAAAGCTCTTCTGATTTTATGTCCACATCTGCTGCAAAGAAAGGAAATTATTCCTTCATAGGGCAAACTGCTAAAAGAGACACAGAAGATCATCCTATATATCTTCCACTCTCTCACCCAGTACATGAGAATCTAGCAATACCAAA...

Protein

Download Protein FASTA

273 aa · LXL04_023023|LXL04_023023|OH1004|PROTEIN

MEDPKNRAFEAIARREAHALQLQQKQNNNKRPFEKKTVESSSDFMSTSAAKKGNYSFIGQTAKRDTEDHPIYLPLSHPVHENLAIPNLQGNVVDKILHELLQSGDSSLHYSQGSRRMKIDNRVHLDNIVKDRKITLTEALQSHSKRSKKHMSMKQLKKYGTLDLPQDHHKFETFRPMHEIWKDYMKQLLKSVGKNQMAQCLLGADLHGALILVAKCKMDGFTGLSGIMIRETAETFGIITKDNKYKVVLKKISVFMLQVD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023023`
TK1151 ID	TkA06G413920
OH-1004 ID	LXL04_023023
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.200
Protein coverage (%)	TK1151 97.482 / OH-1004 99.267 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023023

Location Chr05:19169752-19171856 (-)

Description Similar to POP4: Ribonuclease P protein subunit p29

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g43190`	Component of the MRP ribonuclease complex, which cleaves pre-rRNA sequences.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023023 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001682 tRNA 5'-leader removal Biological Process

GO:0006364 rRNA processing Biological Process

GO:0006396 RNA processing Biological Process

GO:0000172 ribonuclease MRP complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005655 nucleolar ribonuclease P complex Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0030677 ribonuclease P complex Cellular Component

GO:0030681 multimeric ribonuclease P complex Cellular Component

GO:0004526 ribonuclease P activity Molecular Function

GO:0033204 ribonuclease P RNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G43190

bta:614870

hsa:10775

mmu:66161

pon:100173364

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.704

Rank 1 · LXL04_023023 · OH-1004

Cytoplasm0.327

Rank 2 · LXL04_023023 · OH-1004

Mitochondrion0.028

Rank 3 · LXL04_023023 · OH-1004

Endoplasmic reticulum0.024

Rank 4 · LXL04_023023 · OH-1004

Cell membrane0.021

Rank 5 · LXL04_023023 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01868.22RNase_P-MRP_p29201-272 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023023	`PF01868.22`	RNase_P-MRP_p29	201	272	1.9e-17	63.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZW76`	Arabidopsis thaliana	Ribonuclease MRP protein subunit POP4	53.774%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card