LXL04_022997 | RubberDandelionOmics

Gene overview

LXL04_022997

Reference: OH-1004 Chr: Chr05 Coordinates: 16830403-16834402 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1803 bp · LXL04_022997|LXL04_022997|OH1004|cDNA

atgcaGGATTACTCCAAATCAGTAATCCCTTCACACCTCCTCGGCGATCGTGGCTCTAATCTCGTTGTCATCAATACAGGGTCTGGAAACGTACGAATTGGACTCGCTCATCAGGATGCCCCATTCAGTATCCCTCATTGCATTGCCCGCCGTACTACAGGAGCTAATCAATCACCCAGAAGAAATGTGCAAGATCAGATGCTTAATTCTCAAGTTACAACCGCTCAACATGCGGAGAGAGAGAAAGCCTACGACATTAT...

CDS

Download CDS FASTA

1803 bp · LXL04_022997|LXL04_022997|OH1004|CDS

ATGCAGGATTACTCCAAATCAGTAATCCCTTCACACCTCCTCGGCGATCGTGGCTCTAATCTCGTTGTCATCAATACAGGGTCTGGAAACGTACGAATTGGACTCGCTCATCAGGATGCCCCATTCAGTATCCCTCATTGCATTGCCCGCCGTACTACAGGAGCTAATCAATCACCCAGAAGAAATGTGCAAGATCAGATGCTTAATTCTCAAGTTACAACCGCTCAACATGCGGAGAGAGAGAAAGCCTACGACATTAT...

Protein

Download Protein FASTA

600 aa · LXL04_022997|LXL04_022997|OH1004|PROTEIN

MQDYSKSVIPSHLLGDRGSNLVVINTGSGNVRIGLAHQDAPFSIPHCIARRTTGANQSPRRNVQDQMLNSQVTTAQHAEREKAYDIIASLLKIPFLDEEVVNNSYQRKTGRVDVLSQQNSKKESPLMWTDVVHKITDPPLPSEGSSEKSEVLEGGDVEKLESSECRYREFVCGEEAMRISPTEPYCLRRPIRRGHLNISQHYSMQQVLEDIEAIWDWILIEKLHIPHSERNMYSALIVVPETFDDREIKEILSIVLRDLR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022997`
TK1151 ID	TkA06G419110
OH-1004 ID	LXL04_022997
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.200
Protein coverage (%)	TK1151 99.834 / OH-1004 99.667 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022997

Location Chr05:16830403-16834402 (+)

Description Similar to ARP9: Actin-related protein 9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g43500`	Actin-related protein 9.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2XQX0`	Actin-related protein 9.	No verified direct reference in this release
`Os04g0177600`	Actin-related protein 9.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022997 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000723 telomere maintenance Biological Process

GO:0006275 regulation of DNA replication Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0033044 regulation of chromosome organization Biological Process

GO:0034080 CENP-A containing chromatin assembly Biological Process

GO:0045739 positive regulation of DNA repair Biological Process

GO:0045815 transcription initiation-coupled chromatin remodeling Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

KEGG gene cross-reference

ath:AT5G43500

dosa:Os04g0177600

hsa:93973

osa:4335089

spo:2543563

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.516

Rank 1 · LXL04_022997 · OH-1004

Cytoplasm0.478

Rank 2 · LXL04_022997 · OH-1004

Lysosome / Vacuole0.061

Rank 3 · LXL04_022997 · OH-1004

Cell membrane0.051

Rank 4 · LXL04_022997 · OH-1004

Golgi apparatus0.044

Rank 5 · LXL04_022997 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00022.27Actin20-577 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022997	`PF00022.27`	Actin	20	577	6.1e-30	104.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LSW2`	Arabidopsis thaliana	Actin-related protein 9	57.921%	Swiss-Prot	strong database homology
`A2XQX0`	Oryza sativa subsp. indica	Actin-related protein 9	58.872%	Swiss-Prot	strong database homology
`Q0JF03`	Oryza sativa subsp. japonica	Actin-related protein 9	58.872%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card