LXL04_022737 | RubberDandelionOmics

Gene overview

LXL04_022737

Reference: OH-1004 Chr: Chr05 Coordinates: 7231999-7235125 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

558 bp · LXL04_022737|LXL04_022737|OH1004|cDNA

ATGCGaggtgaagaagaaagatggcaccGGCGGGTAAATGGAGCTCGGGCTCAGCGTGAGGACGACACCGTAGGAGTTTGGGTTCAGAAAGATGAGCGGCTTCACGGGTTAACAAAGGCCGACACCGCTCACCCTTATCTCGAACTAAAAGATGGATACGTCAAATGCGGGATGATAACATCGGCGCGTGAGCTGTTCGATTCCTTTCCATCCCAGATGAAGAATTTAAGGTCTTGGAATTGTATGATCAGTGGATATGT...

CDS

Download CDS FASTA

558 bp · LXL04_022737|LXL04_022737|OH1004|CDS

ATGCGAGGTGAAGAAGAAAGATGGCACCGGCGGGTAAATGGAGCTCGGGCTCAGCGTGAGGACGACACCGTAGGAGTTTGGGTTCAGAAAGATGAGCGGCTTCACGGGTTAACAAAGGCCGACACCGCTCACCCTTATCTCGAACTAAAAGATGGATACGTCAAATGCGGGATGATAACATCGGCGCGTGAGCTGTTCGATTCCTTTCCATCCCAGATGAAGAATTTAAGGTCTTGGAATTGTATGATCAGTGGATATGT...

Protein

Download Protein FASTA

185 aa · LXL04_022737|LXL04_022737|OH1004|PROTEIN

MRGEEERWHRRVNGARAQREDDTVGVWVQKDERLHGLTKADTAHPYLELKDGYVKCGMITSARELFDSFPSQMKNLRSWNCMISGYVVVDDGFTLAWELFNEMPDRDLVSWNLMIRCCIKNGKIDLARTLFDRMPEKDVISWAKLIDGYAKSGNINTARHLFDEMPQRDIISCNIIMAGYIQNGG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022737`
TK1151 ID	TkA06G456840
OH-1004 ID	LXL04_022737
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	60.900
Protein coverage (%)	TK1151 53.482 / OH-1004 68.649 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022737

Location Chr05:7231999-7235125 (+)

Description Similar to CRR4: Pentatricopeptide repeat-containing protein At2g45350, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g45350`	Plays a major role in chloroplast RNA editing.	A pentatricopeptide repeat protein is a site recognition factor in chloroplast RNA editing.2006 · DOI: 10.1074/jbc.m608184200 Two interacting proteins are necessary for the editing of the NdhD-1 site in Arabidopsis plastids.2012 · DOI: 10.1105/tpc.112.099507
`At2g35030`	Pentatricopeptide repeat-containing protein At2g35030, mitochondrial.	No verified direct reference in this release
`At4g02750`	Pentatricopeptide repeat-containing protein At4g02750.	No verified direct reference in this release
`At1g09410`	Pentatricopeptide repeat-containing protein At1g09410, mitochondrial.	No verified direct reference in this release
`At5g46460`	Pentatricopeptide repeat-containing protein At5g46460, mitochondrial.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022737 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0009451 RNA modification Biological Process

GO:0016556 mRNA modification Biological Process

GO:0099402 plant organ development Biological Process

GO:1900865 chloroplast RNA modification Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005773 vacuole Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003723 RNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G35030

ath:AT2G45350

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.358

Rank 1 · LXL04_022737 · OH-1004

Plastid0.164

Rank 2 · LXL04_022737 · OH-1004

Cytoplasm0.159

Rank 3 · LXL04_022737 · OH-1004

Nucleus0.147

Rank 4 · LXL04_022737 · OH-1004

Peroxisome0.032

Rank 5 · LXL04_022737 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13041.13PPR_275-106 aa

PF13041.13PPR_2107-138 aa

PF01535.27PPR109-138 aa

PF13041.13PPR_2137-170 aa

PF12854.14PPR_1138-165 aa

PF01535.27PPR141-169 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022737	`PF13041.13`	PPR_2	75	106	2.7e-26	92.1
LXL04_022737	`PF13041.13`	PPR_2	107	138	2.7e-26	92.1
LXL04_022737	`PF01535.27`	PPR	109	138	2.9e-26	90.5
LXL04_022737	`PF13041.13`	PPR_2	137	170	2.7e-26	92.1
LXL04_022737	`PF12854.14`	PPR_1	138	165	1e-15	57.8
LXL04_022737	`PF01535.27`	PPR	141	169	2.9e-26	90.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O22137`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At2g45350, chloroplastic	56.522%	Swiss-Prot	strong database homology
`O64766`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At2g35030, mitochondrial	37.895%	Swiss-Prot	moderate database homology
`Q9SY02`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At4g02750	41.912%	Swiss-Prot	moderate database homology
`Q56XI1`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g09410, mitochondrial	42.105%	Swiss-Prot	moderate database homology
`Q9FHF9`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At5g46460, mitochondrial	39.130%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card