LXL04_022736 | RubberDandelionOmics

Gene overview

LXL04_022736

Reference: OH-1004 Chr: Chr05 Coordinates: 7171391-7174474 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

933 bp · LXL04_022736|LXL04_022736|OH1004|cDNA

ATGTATAGATCTGGAGCTGTGATGGCTTGGAATGTGTTCAAATTCTGTACGGCTCTCAGAGGTTTAGGCTCGATTATGATCTTGCTGGTTCTTGGTGTAGTTGGTGTCTCTTATTACGCCGTCGTTTTGTCCATATATGGCCCTGCTTTGACCTCCGGTGGCCTCGAATCATTCATCGCACTTCTAGTGTTGATCATGTTTCATATCCTGTTGGTGATGCTATTATGGAGTTATTTCTCTGTGGTTCTCACGGACCCTGG...

CDS

Download CDS FASTA

933 bp · LXL04_022736|LXL04_022736|OH1004|CDS

ATGTATAGATCTGGAGCTGTGATGGCTTGGAATGTGTTCAAATTCTGTACGGCTCTCAGAGGTTTAGGCTCGATTATGATCTTGCTGGTTCTTGGTGTAGTTGGTGTCTCTTATTACGCCGTCGTTTTGTCCATATATGGCCCTGCTTTGACCTCCGGTGGCCTCGAATCATTCATCGCACTTCTAGTGTTGATCATGTTTCATATCCTGTTGGTGATGCTATTATGGAGTTATTTCTCTGTGGTTCTCACGGACCCTGG...

Protein

Download Protein FASTA

310 aa · LXL04_022736|LXL04_022736|OH1004|PROTEIN

MYRSGAVMAWNVFKFCTALRGLGSIMILLVLGVVGVSYYAVVLSIYGPALTSGGLESFIALLVLIMFHILLVMLLWSYFSVVLTDPGGVPPNYRPIVDEERGDMDGLTLTGSEFNPLTTPNPTNARIRYCRKCNQMKPPRCHHCSVCGRCVLKMDHHCVWVVNCVGAQNYKYFLLFLFYTILETTLVTLSLLPYFISFFSDGEVAGSPGALATTFLAFVLNLAFALSVLGFLIMHISLVSGNTTTIEAYEKKTTPKWRYD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022736`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022736

Location Chr05:7171391-7174474 (+)

Description Similar to PAT14: Probable protein S-acyltransferase 14

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g60800`	Palmitoyl acyltransferase.	No verified direct reference in this release
`At4g22750`	Palmitoyl acyltransferase.	No verified direct reference in this release
`At4g00840`	Palmitoyl acyltransferase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022736 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006612 protein targeting to membrane Biological Process

GO:0006974 DNA damage response Biological Process

GO:0010150 leaf senescence Biological Process

GO:0016188 synaptic vesicle maturation Biological Process

GO:0018230 peptidyl-L-cysteine S-palmitoylation Biological Process

GO:0018345 protein palmitoylation Biological Process

GO:0019062 virion attachment to host cell Biological Process

GO:0044794 host-mediated activation of viral process Biological Process

GO:1900055 regulation of leaf senescence Biological Process

GO:2000377 regulation of reactive oxygen species metabolic process Biological Process

GO:0000138 Golgi trans cisterna Cellular Component

GO:0000139 Golgi membrane Cellular Component

KEGG gene cross-reference

ath:AT3G60800

ath:AT4G00840

ath:AT4G22750

mmu:75965

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.492

Rank 1 · LXL04_022736 · OH-1004

Endoplasmic reticulum0.258

Rank 2 · LXL04_022736 · OH-1004

Cytoplasm0.242

Rank 3 · LXL04_022736 · OH-1004

Cell membrane0.161

Rank 4 · LXL04_022736 · OH-1004

Lysosome / Vacuole0.100

Rank 5 · LXL04_022736 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01529.26DHHC126-251 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022736	`PF01529.26`	DHHC	126	251	1e-39	136.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYP5`	Arabidopsis thaliana	Probable protein S-acyltransferase 14	77.346%	Swiss-Prot	strong database homology
`Q94C49`	Arabidopsis thaliana	Probable protein S-acyltransferase 13	63.366%	Swiss-Prot	strong database homology
`Q5M757`	Arabidopsis thaliana	Probable protein S-acyltransferase 12	55.184%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card