LXL04_022703 | RubberDandelionOmics

Gene overview

LXL04_022703

Reference: OH-1004 Chr: Chr05 Coordinates: 5474770-5478712 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1308 bp · LXL04_022703|LXL04_022703|OH1004|cDNA

ATGGGTTTCATGTCTGGGATGTTTTTTGGGGCTTTATTTGGAATTGGGATTATGGCGGGTTGGCGTCATATGATGAGGCGACGAAGCAAAAGCCGTACTGCCAAGGCAAGTGACATAAAGCTCCTCGGATCTCTTGATAGAGAAGATTTAAAGAAACTTTGTGGCGATAATTTTCCTGAATGGATATCGTTTCCTGTTTATGAGCAGGTGAAATGGCTGAACAAACAACTGAGCAAACTGTGGCCATATGTTGCCGAAGC...

CDS

Download CDS FASTA

1308 bp · LXL04_022703|LXL04_022703|OH1004|CDS

ATGGGTTTCATGTCTGGGATGTTTTTTGGGGCTTTATTTGGAATTGGGATTATGGCGGGTTGGCGTCATATGATGAGGCGACGAAGCAAAAGCCGTACTGCCAAGGCAAGTGACATAAAGCTCCTCGGATCTCTTGATAGAGAAGATTTAAAGAAACTTTGTGGCGATAATTTTCCTGAATGGATATCGTTTCCTGTTTATGAGCAGGTGAAATGGCTGAACAAACAACTGAGCAAACTGTGGCCATATGTTGCCGAAGC...

Protein

Download Protein FASTA

435 aa · LXL04_022703|LXL04_022703|OH1004|PROTEIN

MGFMSGMFFGALFGIGIMAGWRHMMRRRSKSRTAKASDIKLLGSLDREDLKKLCGDNFPEWISFPVYEQVKWLNKQLSKLWPYVAEAATIIIRESVEPILEEYRPSGISSLKFSKLSLGSVAPKIEGIRIQSAKQGQITMDMDFRWGGDPNIVLGVEAAGVASLPIQLKDLQVFTIIRVIFQLSEEIPCISAVVVALLSEPKPRFDYTLKAVGGSLTAVPGLSDMIEDTVTSIITDMLQWPHRIVVPLGGIPVDTSELEL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022703`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022703

Location Chr05:5474770-5478712 (+)

Description Similar to CLB: Calcium-dependent lipid-binding protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g61050`	May be involved in membrane trafficking (By similarity).	No verified direct reference in this release
`At1g05500`	May be involved in membrane trafficking.	No verified direct reference in this release
`At5g11100`	May be involved in membrane trafficking.	No verified direct reference in this release
`At5g04220`	May be involved in membrane trafficking.	No verified direct reference in this release
`At1g20080`	May play an important role in regulating an unconventional protein trafficking from the cytosol to the extracellular matrix.	Golgi apparatus-localized synaptotagmin 2 is required for unconventional secretion in Arabidopsis.2011 · DOI: 10.1371/journal.pone.0026477

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022703 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006869 lipid transport Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009958 positive gravitropism Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0012505 endomembrane system Cellular Component

GO:0031965 nuclear membrane Cellular Component

GO:0033011 perinuclear theca Cellular Component

KEGG gene cross-reference

ath:AT1G05500

ath:AT3G61050

ath:AT5G11100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.657

Rank 1 · LXL04_022703 · OH-1004

Cytoplasm0.228

Rank 2 · LXL04_022703 · OH-1004

Endoplasmic reticulum0.187

Rank 3 · LXL04_022703 · OH-1004

Golgi apparatus0.117

Rank 4 · LXL04_022703 · OH-1004

Nucleus0.076

Rank 5 · LXL04_022703 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17047.12SMP_LBD68-248 aa

PF25669.2SMP_MUG190-like68-137 aa

PF00168.37C2264-359 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022703	`PF17047.12`	SMP_LBD	68	248	4.8e-16	59.5
LXL04_022703	`PF25669.2`	SMP_MUG190-like	68	137	1.3e-11	45.2
LXL04_022703	`PF00168.37`	C2	264	359	2.2e-22	80.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LEX1`	Arabidopsis thaliana	Calcium-dependent lipid-binding protein	70.093%	Swiss-Prot	strong database homology
`Q8L706`	Arabidopsis thaliana	Synaptotagmin-5	43.325%	Swiss-Prot	moderate database homology
`A0JJX5`	Arabidopsis thaliana	Synaptotagmin-4	42.040%	Swiss-Prot	moderate database homology
`Q7XA06`	Arabidopsis thaliana	Synaptotagmin-3	34.465%	Swiss-Prot	moderate database homology
`B6ETT4`	Arabidopsis thaliana	Synaptotagmin-2	30.296%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card