LXL04_022389 | RubberDandelionOmics

Gene overview

LXL04_022389

Reference: OH-1004 Chr: Chr04 Coordinates: 149474505-149475537 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

471 bp · LXL04_022389|LXL04_022389|OH1004|cDNA

ATGGGGCTTCTTGCAACAATCGCTAGACATCTGGACACGCTAGTCGGGCCTGGAGTAATGCTTCTTTTCCCCTTGTACTCATCAATGCTAGCGCTCGAAAGCCCTACACCAGAAGATGATCAACAGTGGCTCACTTATTGGGTTTTATATTCGTTCATAACCCTCTTCGAGCTTTCATTTTGGAAAGTCCTTCAATGGCTTCCATTTTGGCCCTACTTGAAGCTATTGTTTTGTATGTGGTTGGTGCTACCTGGAATTAA...

CDS

Download CDS FASTA

471 bp · LXL04_022389|LXL04_022389|OH1004|CDS

ATGGGGCTTCTTGCAACAATCGCTAGACATCTGGACACGCTAGTCGGGCCTGGAGTAATGCTTCTTTTCCCCTTGTACTCATCAATGCTAGCGCTCGAAAGCCCTACACCAGAAGATGATCAACAGTGGCTCACTTATTGGGTTTTATATTCGTTCATAACCCTCTTCGAGCTTTCATTTTGGAAAGTCCTTCAATGGCTTCCATTTTGGCCCTACTTGAAGCTATTGTTTTGTATGTGGTTGGTGCTACCTGGAATTAA...

Protein

Download Protein FASTA

156 aa · LXL04_022389|LXL04_022389|OH1004|PROTEIN

MGLLATIARHLDTLVGPGVMLLFPLYSSMLALESPTPEDDQQWLTYWVLYSFITLFELSFWKVLQWLPFWPYLKLLFCMWLVLPGINGASYIYANIARKYVKVGSHVSSKYPEGQRKVLQMMSLDARKSVERYIEKYGPEAFDRVVKAAEKEANKK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022389`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022389

Location Chr04:149474505-149475537 (-)

Description Similar to HVA22F: HVA22-like protein f

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g42820`	HVA22-like protein f.	No verified direct reference in this release
`At1g74520`	HVA22-like protein a.	No verified direct reference in this release
`At1g69700`	HVA22-like protein c.	No verified direct reference in this release
`At5g62490`	HVA22-like protein b.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022389 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0042538 hyperosmotic salinity response Biological Process

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT1G69700

ath:AT1G74520

ath:AT2G42820

ath:AT5G62490

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.797

Rank 1 · LXL04_022389 · OH-1004

Nucleus0.114

Rank 2 · LXL04_022389 · OH-1004

Cytoplasm0.110

Rank 3 · LXL04_022389 · OH-1004

Golgi apparatus0.061

Rank 4 · LXL04_022389 · OH-1004

Mitochondrion0.057

Rank 5 · LXL04_022389 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03134.25TB2_DP1_HVA2224-100 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022389	`PF03134.25`	TB2_DP1_HVA22	24	100	1.7e-26	92.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q682H0`	Arabidopsis thaliana	HVA22-like protein f	63.057%	Swiss-Prot	strong database homology
`Q9S7V4`	Arabidopsis thaliana	HVA22-like protein a	39.333%	Swiss-Prot	moderate database homology
`Q9S784`	Arabidopsis thaliana	HVA22-like protein c	39.597%	Swiss-Prot	moderate database homology
`Q9SYX7`	Arabidopsis thaliana	HVA22-like protein b	49.495%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card