LXL04_022376 | RubberDandelionOmics

Gene overview

LXL04_022376

Reference: OH-1004 Chr: Chr04 Coordinates: 149324329-149325919 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1119 bp · LXL04_022376|LXL04_022376|OH1004|cDNA

ATGCTTTATACCTTGGTTCCTCCACACCACATCTCCCATTGCTGTTTCCTCTCTAACCCCATCAAGCTTCTCCATTCCTCAGATCGTCTTCACCTTCGTCTTCGTCCATCCACCAAGAGAATCCCCCCATCCCATTTCACCACCGGCATCTTTTACTCCCTCTCCGCCATAGACAGCCGAGACAAGCAACAAGACAACAAAGAGACTGATCAATTTCGAGATCACGATGACGACGAGGACGGTGATAGAGCGTTATTGAA...

CDS

Download CDS FASTA

1119 bp · LXL04_022376|LXL04_022376|OH1004|CDS

ATGCTTTATACCTTGGTTCCTCCACACCACATCTCCCATTGCTGTTTCCTCTCTAACCCCATCAAGCTTCTCCATTCCTCAGATCGTCTTCACCTTCGTCTTCGTCCATCCACCAAGAGAATCCCCCCATCCCATTTCACCACCGGCATCTTTTACTCCCTCTCCGCCATAGACAGCCGAGACAAGCAACAAGACAACAAAGAGACTGATCAATTTCGAGATCACGATGACGACGAGGACGGTGATAGAGCGTTATTGAA...

Protein

Download Protein FASTA

372 aa · LXL04_022376|LXL04_022376|OH1004|PROTEIN

MLYTLVPPHHISHCCFLSNPIKLLHSSDRLHLRLRPSTKRIPPSHFTTGIFYSLSAIDSRDKQQDNKETDQFRDHDDDEDGDRALLNRFYDSSPIYLNGTQGKKNDRRQITAIEIKEIPDTDRAESSTGNFASMWWADLKAAIGQRINVEGLLFSVSVITRNKQWVMPHVSVRDIRYIDWAALRRKGYEGVVFDKDNTLTAPYSLALWGPLAASVESCKSVFGNNIAVFSNSAGLEEYDPDGRKARALEYVIGIRVIRHI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022376`
TK1151 ID	TkA05G463800
OH-1004 ID	LXL04_022376
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022376

Location Chr04:149324329-149325919 (+)

Description Similar to PGPP1: Phosphatidylglycerophosphate phosphatase 1, chloroplastic/mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g58830`	Phosphatidylglycerophosphate (PGP) phosphatase involved in the biosynthesis of phosphatidylglycerol (PG), a phosphoglycerolipid predominantly present in chloroplastic thylakoid membranes and which has important photosynthetic function; seems to use PGP 34:3, PGP 34:2 and PGP 34:1 as substrates.	Arabidopsis phosphatidylglycerophosphate phosphatase 1 involved in phosphatidylglycerol biosynthesis and photosynthetic function.2016 · DOI: 10.1111/tpj.13311 Identification and characterization of a plastidial phosphatidylglycerophosphate phosphatase in Arabidopsis thaliana.2017 · DOI: 10.1111/tpj.13378 Phosphatidylglycerophosphate phosphatase is required for root growth in Arabidopsis.2018 · DOI: 10.1016/j.bbalip.2018.02.007

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022376 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006655 phosphatidylglycerol biosynthetic process Biological Process

GO:0007006 mitochondrial membrane organization Biological Process

GO:0008610 lipid biosynthetic process Biological Process

GO:0008654 phospholipid biosynthetic process Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0010027 thylakoid membrane organization Biological Process

GO:0015979 photosynthesis Biological Process

GO:0032049 cardiolipin biosynthetic process Biological Process

GO:0046486 glycerolipid metabolic process Biological Process

GO:0046839 phospholipid dephosphorylation Biological Process

GO:0048364 root development Biological Process

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT3G58830

bsu:BSU25680

sce:YHR100C

spo:2539038

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.936

Rank 1 · LXL04_022376 · OH-1004

Nucleus0.049

Rank 2 · LXL04_022376 · OH-1004

Mitochondrion0.043

Rank 3 · LXL04_022376 · OH-1004

Cytoplasm0.034

Rank 4 · LXL04_022376 · OH-1004

Cell membrane0.024

Rank 5 · LXL04_022376 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09419.17PGP_phosphatase154-319 aa

PF13242.13Hydrolase_like277-317 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022376	`PF09419.17`	PGP_phosphatase	154	319	3.1e-38	131.7
LXL04_022376	`PF13242.13`	Hydrolase_like	277	317	2.9e-06	27.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LXR9`	Arabidopsis thaliana	Phosphatidylglycerophosphate phosphatase 1, chloroplastic/mitochondrial	67.811%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card