LXL04_022371 | RubberDandelionOmics

Gene overview

LXL04_022371

Reference: OH-1004 Chr: Chr04 Coordinates: 149292397-149295556 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1674 bp · LXL04_022371|LXL04_022371|OH1004|cDNA

TTTGAGTATTTAGCTTCGGTCGATCAATCTTGCAAGCAAGCTCTGTTTATATACGGAAACAATCAAATTGACGATTTGCAATTCGATTTTTCAAGAGAAATGGGACGTGAAGTAGCAGATAACTCAAGTGTGGCCGCTCGTGGAAGATTAGCTGTTCTATCAGCTCATCTCTCTGCTTGTCTTGAATCCAGTGCTTTTACTCCAGTTCTCGAGTCATCATGCACCTCCGCTCAGGTGTTTGTGGCTCCACCTCCCAATTT...

CDS

Download CDS FASTA

1632 bp · LXL04_022371|LXL04_022371|OH1004|CDS

CTGTTTATATACGGAAACAATCAAATTGACGATTTGCAATTCGATTTTTCAAGAGAAATGGGACGTGAAGTAGCAGATAACTCAAGTGTGGCCGCTCGTGGAAGATTAGCTGTTCTATCAGCTCATCTCTCTGCTTGTCTTGAATCCAGTGCTTTTACTCCAGTTCTCGAGTCATCATGCACCTCCGCTCAGGTGTTTGTGGCTCCACCTCCCAATTTGAAAGGATCGTTGGTGATCGCCGATGAACGAACCGGCAAGAA...

Protein

Download Protein FASTA

543 aa · LXL04_022371|LXL04_022371|OH1004|PROTEIN

MFIYGNNQIDDLQFDFSREMGREVADNSSVAARGRLAVLSAHLSACLESSAFTPVLESSCTSAQVFVAPPPNLKGSLVIADERTGKKYKVQVSEEGTVRATDLKKITTGNEDKGLKLYDPGFLNTAPVRSSICYIDGDEGILRYRGYPIEELAESSSFLDVAYLLSNSSFPFLYGNLPSQSQLADWEFTVAQHSAVPQGILDIIHAMPHDAHPMGVLVSAMSALSVFHPDANPALRGQDLYKSKPVRDKQIVRILGKAPT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022371`
TK1151 ID	TkA05G463670
OH-1004 ID	LXL04_022371
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.600
Protein coverage (%)	TK1151 97.455 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022371

Location Chr04:149292397-149295556 (-)

Description Similar to Citrate synthase, glyoxysomal

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g58750`	Peroxisomal citrate synthase required for the fatty acid respiration in seedlings, citrate being exported from peroxisomes into mitochondria during respiration of triacylglycerol (TAG).	No verified direct reference in this release
`At2g42790`	Peroxisomal citrate synthase required for the fatty acid respiration in seedlings, citrate being exported from peroxisomes into mitochondria during respiration of triacylglycerol (TAG).	No verified direct reference in this release
`At3g58740`	Citrate synthase 1, peroxisomal.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022371 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006097 glyoxylate cycle Biological Process

GO:0006099 tricarboxylic acid cycle Biological Process

GO:0006635 fatty acid beta-oxidation Biological Process

GO:0006897 endocytosis Biological Process

GO:0006907 pinocytosis Biological Process

GO:0006909 phagocytosis Biological Process

GO:0019954 asexual reproduction Biological Process

GO:0050766 positive regulation of phagocytosis Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005777 peroxisome Cellular Component

KEGG gene cross-reference

ath:AT2G42790

ath:AT3G58740

ath:AT3G58750

cmax:111483841

ddi:DDB_G0267426

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Peroxisome0.526

Rank 1 · LXL04_022371 · OH-1004

Cytoplasm0.299

Rank 2 · LXL04_022371 · OH-1004

Mitochondrion0.175

Rank 3 · LXL04_022371 · OH-1004

Nucleus0.099

Rank 4 · LXL04_022371 · OH-1004

Plastid0.072

Rank 5 · LXL04_022371 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00285.27Citrate_synt121-497 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022371	`PF00285.27`	Citrate_synt	121	497	2.8e-131	438.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LXS6`	Arabidopsis thaliana	Citrate synthase 2, peroxisomal	82.387%	Swiss-Prot	strong database homology
`Q9SJH7`	Arabidopsis thaliana	Citrate synthase 3, peroxisomal	80.859%	Swiss-Prot	strong database homology
`Q9LXS7`	Arabidopsis thaliana	Citrate synthase 1, peroxisomal	72.878%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card