LXL04_022266 | RubberDandelionOmics

Gene overview

LXL04_022266

Reference: OH-1004 Chr: Chr04 Coordinates: 147133598-147136014 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1164 bp · LXL04_022266|LXL04_022266|OH1004|cDNA

ATGGCCGGGAAAAGCTCCAGCAACACCGCCGGCAAGCCCATCCACTGCAGAGCTGCGATTGCTAGAAAAGCAGGGGAACCGCTGGTGATAGAGGAGGTGATAGTGGCCCCACCAAAACCTCATGAAGTCAGAATCAAAATTACATGCACTTCTCTTTGTCACACTGATGTTACCTTTTGGAAACTTGAGCATCCTCCTGGTATTTTCCCCATAATATTTGGTCATGAAGCAGTAGGGATCGTGGAGAGTGTGGGAGAAGG...

CDS

Download CDS FASTA

1164 bp · LXL04_022266|LXL04_022266|OH1004|CDS

ATGGCCGGGAAAAGCTCCAGCAACACCGCCGGCAAGCCCATCCACTGCAGAGCTGCGATTGCTAGAAAAGCAGGGGAACCGCTGGTGATAGAGGAGGTGATAGTGGCCCCACCAAAACCTCATGAAGTCAGAATCAAAATTACATGCACTTCTCTTTGTCACACTGATGTTACCTTTTGGAAACTTGAGCATCCTCCTGGTATTTTCCCCATAATATTTGGTCATGAAGCAGTAGGGATCGTGGAGAGTGTGGGAGAAGG...

Protein

Download Protein FASTA

387 aa · LXL04_022266|LXL04_022266|OH1004|PROTEIN

MAGKSSSNTAGKPIHCRAAIARKAGEPLVIEEVIVAPPKPHEVRIKITCTSLCHTDVTFWKLEHPPGIFPIIFGHEAVGIVESVGEGVHEVVEGDTVIPIFLPDCGECTDCLSDKSNICSKFPLRPSFGMQRDDTSRFTDINGETLNHFLFVSSFSEYTVVDIAHVTKINPTIPPNRACLLGCGISTGVGAAWKTAKVEVGSTVAIFGLGAIGLAVAEGARLCGAKRIIGVDVNQDKCEIGKKFGVTDFVNSRNIGDKTV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022266`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022266

Location Chr04:147133598-147136014 (+)

Description Similar to At5g42250: Alcohol dehydrogenase-like 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g42250`	Alcohol dehydrogenase-like 7.	No verified direct reference in this release
`At1g22430`	Alcohol dehydrogenase-like 1.	No verified direct reference in this release
`At1g22440`	Alcohol dehydrogenase-like 2.	No verified direct reference in this release
`At4g22110`	Alcohol dehydrogenase-like 5.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2XAZ3`	Alcohol dehydrogenase class-3.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022266 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0046294 formaldehyde catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004022 alcohol dehydrogenase (NAD+) activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0051903 S-(hydroxymethyl)glutathione dehydrogenase [NAD(P)+] activity Molecular Function

GO:0106321 S-(hydroxymethyl)glutathione dehydrogenase (NADP+) activity Molecular Function

GO:0106322 S-(hydroxymethyl)glutathione dehydrogenase (NAD+) activity Molecular Function

KEGG gene cross-reference

ath:AT1G22430

ath:AT1G22440

ath:AT4G22110

ath:AT5G42250

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.592

Rank 1 · LXL04_022266 · OH-1004

Nucleus0.194

Rank 2 · LXL04_022266 · OH-1004

Cell membrane0.104

Rank 3 · LXL04_022266 · OH-1004

Peroxisome0.081

Rank 4 · LXL04_022266 · OH-1004

Mitochondrion0.080

Rank 5 · LXL04_022266 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08240.18ADH_N39-169 aa

PF00107.33ADH_zinc_N211-336 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022266	`PF08240.18`	ADH_N	39	169	6.2e-21	75.3
LXL04_022266	`PF00107.33`	ADH_zinc_N	211	336	4.2e-26	92.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FH04`	Arabidopsis thaliana	Alcohol dehydrogenase-like 7	68.912%	Swiss-Prot	strong database homology
`Q9SK86`	Arabidopsis thaliana	Alcohol dehydrogenase-like 1	61.358%	Swiss-Prot	strong database homology
`Q9SK87`	Arabidopsis thaliana	Alcohol dehydrogenase-like 2	60.156%	Swiss-Prot	strong database homology
`Q0V7W6`	Arabidopsis thaliana	Alcohol dehydrogenase-like 5	61.478%	Swiss-Prot	strong database homology
`A2XAZ3`	Oryza sativa subsp. indica	Alcohol dehydrogenase class-3	51.175%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card