LXL04_022244 | RubberDandelionOmics

Gene overview

LXL04_022244

Reference: OH-1004 Chr: Chr04 Coordinates: 146749793-146754375 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4203 bp · LXL04_022244|LXL04_022244|OH1004|cDNA

ATGAAAGAATGCGTAATTATTCGCTCGAAACCCTTGGCTCGAGCACTACATTGTCAGCTGATCACAACTGGGTTAGACTTTTCAACTTTTGTTCAGAATAACTTAGTCAACTTGTACGCGGGTTGTGGTTTGATCGATGATGCGTCATTAGTATTTAATGAGATTGAGTTAAAAAACGTGTTTAGTTGGAACACGATGATCAAGGGTTTGATTGATTCAGGGCGGGTTACGGCTGCAGAGATgctgtttgatgaaatgcc...

CDS

Download CDS FASTA

4203 bp · LXL04_022244|LXL04_022244|OH1004|CDS

ATGAAAGAATGCGTAATTATTCGCTCGAAACCCTTGGCTCGAGCACTACATTGTCAGCTGATCACAACTGGGTTAGACTTTTCAACTTTTGTTCAGAATAACTTAGTCAACTTGTACGCGGGTTGTGGTTTGATCGATGATGCGTCATTAGTATTTAATGAGATTGAGTTAAAAAACGTGTTTAGTTGGAACACGATGATCAAGGGTTTGATTGATTCAGGGCGGGTTACGGCTGCAGAGATGCTGTTTGATGAAATGCC...

Protein

Download Protein FASTA

1400 aa · LXL04_022244|LXL04_022244|OH1004|PROTEIN

MKECVIIRSKPLARALHCQLITTGLDFSTFVQNNLVNLYAGCGLIDDASLVFNEIELKNVFSWNTMIKGLIDSGRVTAAEMLFDEMPQRDVVSWNSMMSGYFHNGLPENTVEVFISMVRCFNSPPDALSLTCVMKACASLKNLSLAFQLHSFAEKFKFLGDNDLESSIVDMYIKCGAPEIAEHVFLNIPTPNLFSWNSMIHGYSILHGAQRALELFDEMPKRNVVSWNMIISILSKHGHVTKTLGMFIEMCIQGFRPNSM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022244`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022244

Location Chr04:146749793-146754375 (+)

Description Similar to PHT1-9: Probable inorganic phosphate transporter 1-9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g76430`	High-affinity transporter for external inorganic phosphate.	No verified direct reference in this release
`At1g20860`	High-affinity transporter for external inorganic phosphate.	No verified direct reference in this release
`At4g13650`	Pentatricopeptide repeat-containing protein At4g13650.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0324800`	High-affinity transporter for external inorganic phosphate.	No verified direct reference in this release
`Os06g0325200`	High-affinity transporter for external inorganic phosphate.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022244 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006817 phosphate ion transport Biological Process

GO:0009451 RNA modification Biological Process

GO:1901684 arsenate ion transmembrane transport Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0005315 phosphate transmembrane transporter activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0015293 symporter activity Molecular Function

GO:0015415 ATPase-coupled phosphate ion transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G20860

ath:AT1G76430

ath:AT4G13650

dosa:Os06g0324800

dosa:Os06g0325200

osa:4340904

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.510

Rank 1 · LXL04_022244 · OH-1004

Mitochondrion0.198

Rank 2 · LXL04_022244 · OH-1004

Endoplasmic reticulum0.088

Rank 3 · LXL04_022244 · OH-1004

Peroxisome0.039

Rank 4 · LXL04_022244 · OH-1004

Cytoplasm0.039

Rank 5 · LXL04_022244 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13041.13PPR_258-90 aa

PF12854.14PPR_159-86 aa

PF01535.27PPR61-90 aa

PF13041.13PPR_289-138 aa

PF01535.27PPR92-119 aa

PF13041.13PPR_2191-224 aa

PF01535.27PPR194-224 aa

PF13041.13PPR_2222-269 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022244	`PF13041.13`	PPR_2	58	90	1.5e-93	307.5
LXL04_022244	`PF12854.14`	PPR_1	59	86	2.1e-43	146.4
LXL04_022244	`PF01535.27`	PPR	61	90	2e-85	275.9
LXL04_022244	`PF13041.13`	PPR_2	89	138	1.5e-93	307.5
LXL04_022244	`PF01535.27`	PPR	92	119	2e-85	275.9
LXL04_022244	`PF13041.13`	PPR_2	191	224	1.5e-93	307.5
LXL04_022244	`PF01535.27`	PPR	194	224	2e-85	275.9
LXL04_022244	`PF13041.13`	PPR_2	222	269	1.5e-93	307.5
LXL04_022244	`PF13041.13`	PPR_2	324	371	1.5e-93	307.5
LXL04_022244	`PF01535.27`	PPR	326	353	2e-85	275.9
LXL04_022244	`PF13041.13`	PPR_2	424	457	1.5e-93	307.5
LXL04_022244	`PF01535.27`	PPR	427	457	2e-85	275.9
LXL04_022244	`PF13041.13`	PPR_2	455	504	1.5e-93	307.5
LXL04_022244	`PF01535.27`	PPR	458	488	2e-85	275.9
LXL04_022244	`PF13041.13`	PPR_2	557	604	1.5e-93	307.5
LXL04_022244	`PF01535.27`	PPR	559	589	2e-85	275.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9S735`	Arabidopsis thaliana	Probable inorganic phosphate transporter 1-9	57.306%	Swiss-Prot	weak database homology
`Q9SYQ1`	Arabidopsis thaliana	Probable inorganic phosphate transporter 1-8	55.048%	Swiss-Prot	weak database homology
`Q9SVP7`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At4g13650	34.459%	Swiss-Prot	moderate database homology
`Q8H6G7`	Oryza sativa subsp. japonica	Probable inorganic phosphate transporter 1-9	51.789%	Swiss-Prot	weak database homology
`Q69T94`	Oryza sativa subsp. japonica	Probable inorganic phosphate transporter 1-10	52.571%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card