LXL04_022233 | RubberDandelionOmics

Gene overview

LXL04_022233

Reference: OH-1004 Chr: Chr04 Coordinates: 146569330-146582075 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3081 bp · LXL04_022233|LXL04_022233|OH1004|cDNA

ATGgatccctacaagGAATCGAAACTCATCCTCCCTCCCCCTGATCAACGCCCTTCAAGTGCTTACAATACCCCATTCTGCACAACAAACGCCGGTTTACCGGTGTACAACAATACTGCATCCCTGACTGTTGGAAACAGAGGGCCGATTCTACTTGAGGATTATCATCTGATTGAAAAACTAGCAAACTTCACTCGTGAGCGTATCCCAGAACGTATAGTCCACGCGAGGGGTGCCAGTGCAAAGGGATTCTTCGAGGT...

CDS

Download CDS FASTA

3081 bp · LXL04_022233|LXL04_022233|OH1004|CDS

ATGGATCCCTACAAGGAATCGAAACTCATCCTCCCTCCCCCTGATCAACGCCCTTCAAGTGCTTACAATACCCCATTCTGCACAACAAACGCCGGTTTACCGGTGTACAACAATACTGCATCCCTGACTGTTGGAAACAGAGGGCCGATTCTACTTGAGGATTATCATCTGATTGAAAAACTAGCAAACTTCACTCGTGAGCGTATCCCAGAACGTATAGTCCACGCGAGGGGTGCCAGTGCAAAGGGATTCTTCGAGGT...

Protein

Download Protein FASTA

1026 aa · LXL04_022233|LXL04_022233|OH1004|PROTEIN

MDPYKESKLILPPPDQRPSSAYNTPFCTTNAGLPVYNNTASLTVGNRGPILLEDYHLIEKLANFTRERIPERIVHARGASAKGFFEVTHDITHLTCADFLRAPGVQTPTIVRFSTVIHERGSPETIRDPRGFATKFYTREGNFDIVGNNFPVFFTRDAMAFPDVIHAFKPNPKSHIQEDWRILDFLSHHPESLNTMTFWLDDLGIPTDYRHMEGSSVNTLTLVNKEGKTHYVKFTWKPTCGVKCLMDDEAIKIGGANHSH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022233`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_022233`
Location	Chr04:146569330-146582075 (+)
Description	Similar to Catalase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_022233` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006979 response to oxidative stress Biological Process GO:0009845 seed germination Biological Process GO:0042542 response to hydrogen peroxide Biological Process GO:0042744 hydrogen peroxide catabolic process Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005777 peroxisome Cellular Component GO:0005782 peroxisomal matrix Cellular Component GO:0005829 cytosol Cellular Component GO:0005886 plasma membrane Cellular Component GO:0009514 glyoxysome Cellular Component GO:0004096 catalase activity Molecular Function
KEGG gene cross-reference	ghi:107922122 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.748

Rank 1 · LXL04_022233 · OH-1004

Nucleus0.226

Rank 2 · LXL04_022233 · OH-1004

Mitochondrion0.095

Rank 3 · LXL04_022233 · OH-1004

Cell membrane0.092

Rank 4 · LXL04_022233 · OH-1004

Endoplasmic reticulum0.058

Rank 5 · LXL04_022233 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00199.25Catalase28-407 aa

PF06628.18Catalase-rel435-496 aa

PF00199.25Catalase548-927 aa

PF06628.18Catalase-rel953-1016 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022233	`PF00199.25`	Catalase	28	407		1125.0
LXL04_022233	`PF06628.18`	Catalase-rel	435	496	7e-32	110.1
LXL04_022233	`PF00199.25`	Catalase	548	927		1125.0
LXL04_022233	`PF06628.18`	Catalase-rel	953	1016	7e-32	110.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card