LXL04_022208 | RubberDandelionOmics

Gene overview

LXL04_022208

Reference: OH-1004 Chr: Chr04 Coordinates: 146088351-146091404 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3054 bp · LXL04_022208|LXL04_022208|OH1004|cDNA

ATGGATGATTCTCACGATCGTCGGAACATCCGGAATATGTGCATTCTTGCTCATGTTGATCATGGAAAGACTACTCTTGCCGATCACCTGATTGCCTCGTCTGGAGGTGGGGTTCTCCATCCCAAACAAGCTGGTCGACTTCGGTTCATGGATTATCTAGACGAAGAACAAAGGCGGGCGATAACCATGAAGAGTTCCTCAATCGGTCTTCAATACAAGGGTCACGCGATAAACCTTATTGATTCACCTGGTCATATGGA...

CDS

Download CDS FASTA

3054 bp · LXL04_022208|LXL04_022208|OH1004|CDS

ATGGATGATTCTCACGATCGTCGGAACATCCGGAATATGTGCATTCTTGCTCATGTTGATCATGGAAAGACTACTCTTGCCGATCACCTGATTGCCTCGTCTGGAGGTGGGGTTCTCCATCCCAAACAAGCTGGTCGACTTCGGTTCATGGATTATCTAGACGAAGAACAAAGGCGGGCGATAACCATGAAGAGTTCCTCAATCGGTCTTCAATACAAGGGTCACGCGATAAACCTTATTGATTCACCTGGTCATATGGA...

Protein

Download Protein FASTA

1017 aa · LXL04_022208|LXL04_022208|OH1004|PROTEIN

MDDSHDRRNIRNMCILAHVDHGKTTLADHLIASSGGGVLHPKQAGRLRFMDYLDEEQRRAITMKSSSIGLQYKGHAINLIDSPGHMDFCSEVSTASRLSDGGLVLVDAVEGVHIQTHAVLRQAWIEKLTPCLVLNKIDRLIVELKLSPMEAYNRLQRIVHEVNSIVSTYKSEKYLSDVDSILAGPAGEVSDENQELIEDDEEDTFQPQKGNVVFACALDGWGFSICEFADFYASKLGASSSILQKAFWGPRYFIPKTKMI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022208`
TK1151 ID	TkA05G450730
OH-1004 ID	LXL04_022208
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 29.892 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_022208`
Location	Chr04:146088351-146091404 (-)
Description	Similar to Efl1: Elongation factor-like GTPase 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_022208` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006414 translational elongation Biological Process GO:0042254 ribosome biogenesis Biological Process GO:0042256 cytosolic ribosome assembly Biological Process GO:0046039 GTP metabolic process Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:1990904 ribonucleoprotein complex Cellular Component GO:0003746 translation elongation factor activity Molecular Function GO:0003924 GTPase activity Molecular Function GO:0005525 GTP binding Molecular Function GO:0043022 ribosome binding Molecular Function
KEGG gene cross-reference	dme:Dmel_CG2238 gga:396325 mmu:101592 spo:2539293 xla:380348 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.577

Rank 1 · LXL04_022208 · OH-1004

Nucleus0.310

Rank 2 · LXL04_022208 · OH-1004

Mitochondrion0.127

Rank 3 · LXL04_022208 · OH-1004

Peroxisome0.066

Rank 4 · LXL04_022208 · OH-1004

Golgi apparatus0.050

Rank 5 · LXL04_022208 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00009.34GTP_EFTU9-225 aa

PF22042.3EF-G_D2443-524 aa

PF03144.32GTP_EFTU_D2444-523 aa

PF14492.13EFG_III541-610 aa

PF25118.2EFL1660-743 aa

PF00679.31EFG_C876-960 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022208	`PF00009.34`	GTP_EFTU	9	225	1.1e-45	156.3
LXL04_022208	`PF22042.3`	EF-G_D2	443	524	4e-08	34.0
LXL04_022208	`PF03144.32`	GTP_EFTU_D2	444	523	1.1e-07	32.8
LXL04_022208	`PF14492.13`	EFG_III	541	610	7.8e-08	33.0
LXL04_022208	`PF25118.2`	EFL1	660	743	1.5e-12	48.7
LXL04_022208	`PF00679.31`	EFG_C	876	960	2e-17	63.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card