LXL04_022202 | RubberDandelionOmics

Gene overview

LXL04_022202

Reference: OH-1004 Chr: Chr04 Coordinates: 146000318-146002187 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1023 bp · LXL04_022202|LXL04_022202|OH1004|cDNA

ATGGAGAACGAGAAGAAAGCTTCACCCGTTTCGGATATGGGCGCATGGGCTATGAATGTTATTAGCTCTGTGGGAATCATCATGGCGAACAAGCAACTCATGTCCGCCAATGGCTATTCGTTCACCTTCGCTACAACATTAACAGGATTCCACTTTGCTGTTACCGCACTGGTCGGATTCGTATCAAATTCAACAGGATACACCGCATCAAAGCATGTCCCTTTATGGGAGCTTCTCTGGTTCTCAATCGTCGCAAACAT...

CDS

Download CDS FASTA

1023 bp · LXL04_022202|LXL04_022202|OH1004|CDS

ATGGAGAACGAGAAGAAAGCTTCACCCGTTTCGGATATGGGCGCATGGGCTATGAATGTTATTAGCTCTGTGGGAATCATCATGGCGAACAAGCAACTCATGTCCGCCAATGGCTATTCGTTCACCTTCGCTACAACATTAACAGGATTCCACTTTGCTGTTACCGCACTGGTCGGATTCGTATCAAATTCAACAGGATACACCGCATCAAAGCATGTCCCTTTATGGGAGCTTCTCTGGTTCTCAATCGTCGCAAACAT...

Protein

Download Protein FASTA

340 aa · LXL04_022202|LXL04_022202|OH1004|PROTEIN

MENEKKASPVSDMGAWAMNVISSVGIIMANKQLMSANGYSFTFATTLTGFHFAVTALVGFVSNSTGYTASKHVPLWELLWFSIVANMSITGMNLSLMLNSVGFYQISKLSMIPVVCVMEWIIHSKRYSKEVKVAVVVVVIGVGVCTVTDVKVNAKGFICACVAVLATSLQQISIGSLQKKYSIGAFELLSKTAPIQALSLLVFGPFIDYYLSGRLISTYMKTISSGAIIFILISCSLAVFCNISQYLCIGRFSAVSFQVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022202`
TK1151 ID	TkA05G450340
OH-1004 ID	LXL04_022202
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022202

Location Chr04:146000318-146002187 (+)

Description Similar to URGT2: UDP-rhamnose/UDP-galactose transporter 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g21070`	Nucleotide-sugar transporter that transports UDP-rhamnose or UDP-galactose and UMP in a strict counter-exchange mode.	No verified direct reference in this release
`At5g42420`	Nucleotide-sugar transporter that transports UDP-rhamnose or UDP-galactose and UMP in a strict counter-exchange mode.	No verified direct reference in this release
`At1g76670`	Nucleotide-sugar transporter that transports UDP-rhamnose or UDP-galactose and UMP in a strict counter-exchange mode.	Molecular cloning of two Arabidopsis UDP-galactose transporters by complementation of a deficient Chinese hamster ovary cell line.2005 · DOI: 10.1093/glycob/cwh159
`At4g09810`	Nucleotide-sugar transporter that transports UDP-rhamnose or UDP-galactose and UMP in a strict counter-exchange mode.	No verified direct reference in this release
`At1g34020`	Nucleotide-sugar transporter that transports UDP-rhamnose or UDP-galactose and UMP in a strict counter-exchange mode.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022202 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009624 response to nematode Biological Process

GO:0009833 plant-type primary cell wall biogenesis Biological Process

GO:0015783 GDP-fucose transmembrane transport Biological Process

GO:0015786 UDP-glucose transmembrane transport Biological Process

GO:0048354 mucilage biosynthetic process involved in seed coat development Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0072334 UDP-galactose transmembrane transport Biological Process

GO:1904659 D-glucose transmembrane transport Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005457 GDP-fucose transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G21070

ath:AT1G34020

ath:AT1G76670

ath:AT4G09810

ath:AT5G42420

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.736

Rank 1 · LXL04_022202 · OH-1004

Endoplasmic reticulum0.178

Rank 2 · LXL04_022202 · OH-1004

Cytoplasm0.118

Rank 3 · LXL04_022202 · OH-1004

Cell membrane0.051

Rank 4 · LXL04_022202 · OH-1004

Lysosome / Vacuole0.044

Rank 5 · LXL04_022202 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03151.23TPT23-299 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022202	`PF03151.23`	TPT	23	299	2.7e-19	70.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LPU2`	Arabidopsis thaliana	UDP-rhamnose/UDP-galactose transporter 2	78.261%	Swiss-Prot	strong database homology
`Q9FIH5`	Arabidopsis thaliana	UDP-rhamnose/UDP-galactose transporter 3	76.437%	Swiss-Prot	strong database homology
`Q9SRE4`	Arabidopsis thaliana	UDP-rhamnose/UDP-galactose transporter 1	78.261%	Swiss-Prot	strong database homology
`Q9SZ96`	Arabidopsis thaliana	UDP-rhamnose/UDP-galactose transporter 5	49.412%	Swiss-Prot	moderate database homology
`Q9FDZ5`	Arabidopsis thaliana	UDP-rhamnose/UDP-galactose transporter 6	49.394%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card