Gene Card
Gene overview
cDNA / CDS / Protein Sequences
807 bp · LXL04_022178|LXL04_022178|OH1004|cDNA
ATGGCAATTCCTTCGGTGTTGCTAAACTTCATGtttccaccaccaccatcctTATTCGTCACCACAATGTCGGTCATTGGTCTTACGTCTTTATCAAATGCGGGGTACATGGAGATTAAAGGCAAGCATATGCAATATTCCAAATTCTTGAACGAGGGTGTTGTAAAGAAGGAGAATGATGCAAAGTTGTCGAGTAGAAACGGTATGCTTCTATCGTATACACCCGCGTTTCTTGTGGGCTTGGCTTCTTTAGTCGCGTT...
807 bp · LXL04_022178|LXL04_022178|OH1004|CDS
ATGGCAATTCCTTCGGTGTTGCTAAACTTCATGTTTCCACCACCACCATCCTTATTCGTCACCACAATGTCGGTCATTGGTCTTACGTCTTTATCAAATGCGGGGTACATGGAGATTAAAGGCAAGCATATGCAATATTCCAAATTCTTGAACGAGGGTGTTGTAAAGAAGGAGAATGATGCAAAGTTGTCGAGTAGAAACGGTATGCTTCTATCGTATACACCCGCGTTTCTTGTGGGCTTGGCTTCTTTAGTCGCGTT...
Protein
Download Protein FASTA268 aa · LXL04_022178|LXL04_022178|OH1004|PROTEIN
MAIPSVLLNFMFPPPPSLFVTTMSVIGLTSLSNAGYMEIKGKHMQYSKFLNEGVVKKENDAKLSSRNGMLLSYTPAFLVGLASLVAFPDQDLRFMLLASALTVHFLKRALEVLFLHKYSGSMALESTIIITLSYTFSTATMIYAQYLSRDFPEPSLDLKYVGIGLFAVGIIGNFYHHYILANLRKDGEKEYKIPQGGLFDLVICPHYLFEILGYVGISCISQTLYAFAFTLGTIFYLTGRSYATRQWYLSKFGDKFPKDV...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_022178 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_022178 |
|---|---|
| Location | Chr04:145738953-145740020 (-) |
| Description | Similar to gpsn2: Very-long-chain enoyl-CoA reductase |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006665 sphingolipid metabolic process Biological Process GO:0006694 steroid biosynthetic process Biological Process GO:0006702 androgen biosynthetic process Biological Process GO:0006710 androgen catabolic process Biological Process GO:0008209 androgen metabolic process Biological Process GO:0009267 cellular response to starvation Biological Process GO:0009410 response to xenobiotic stimulus Biological Process GO:0014850 response to muscle activity Biological Process GO:0016101 diterpenoid metabolic process Biological Process GO:0016132 brassinosteroid biosynthetic process Biological Process GO:0030154 cell differentiation Biological Process GO:0030497 fatty acid elongation Biological Process |
| KEGG gene cross-reference | bdi:100827766 ddi:DDB_G0270270 ghi:107948867 mmu:78925 rno:24950 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF02544.22Steroid_dh129-268 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_022178 | PF02544.22 | Steroid_dh | 129 | 268 | 4.3e-31 | 108.6 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.