LXL04_022125 | RubberDandelionOmics

Gene overview

LXL04_022125

Reference: OH-1004 Chr: Chr04 Coordinates: 145034882-145038119 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2115 bp · LXL04_022125|LXL04_022125|OH1004|cDNA

ATGCGTTCAAGCtttcctttttctccttttacaATTGTTTCAGCATCATTCTTCAATAGATTACGCCGATATACACTGAAATTGGCCACTGATCAACTGGACATCAGAGGCTATAATCATCCATCGATTCAACTATCTGATATCACTATCCAAAATCTCTTCACGCAGTCGAAATACAGAGTTCCCTCGGTTTTGTTAAAGGTGATTGAATTCGATATTCCTCTTTCAGGTGTTGCCATGATGTCATATGAAGCAGTTTT...

CDS

Download CDS FASTA

2115 bp · LXL04_022125|LXL04_022125|OH1004|CDS

ATGCGTTCAAGCTTTCCTTTTTCTCCTTTTACAATTGTTTCAGCATCATTCTTCAATAGATTACGCCGATATACACTGAAATTGGCCACTGATCAACTGGACATCAGAGGCTATAATCATCCATCGATTCAACTATCTGATATCACTATCCAAAATCTCTTCACGCAGTCGAAATACAGAGTTCCCTCGGTTTTGTTAAAGGTGATTGAATTCGATATTCCTCTTTCAGGTGTTGCCATGATGTCATATGAAGCAGTTTT...

Protein

Download Protein FASTA

704 aa · LXL04_022125|LXL04_022125|OH1004|PROTEIN

MRSSFPFSPFTIVSASFFNRLRRYTLKLATDQLDIRGYNHPSIQLSDITIQNLFTQSKYRVPSVLLKVIEFDIPLSGVAMMSYEAVLQVFCGAAPRYVYPNPCFDVKYSHGSITKCRKRSRSNAIRFFRSSTVHTPPILHEKLKNTRFDNLSCKCQTSESVSRFTTDKGNENGAWVVNNSKQFNNAVQDTNHPPNLSDLNDIHKFKSEKDDSVPDTIEEEAWDLLRESIVTYCGSPIGTIAANDPTSSSVLNYDQVFIRD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022125`
TK1151 ID	TkA05G446540
OH-1004 ID	LXL04_022125
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 88.778 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022125

Location Chr04:145034882-145038119 (+)

Description Similar to INVE: Alkaline/neutral invertase E, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g22510`	Chloroplastic invertase that cleaves sucrose into glucose and fructose and is associated with the development of the photosynthetic apparatus and the assimilation of nitrogen in seedlings to control the sucrose to hexose ratio.	New insights on sucrose metabolism: evidence for an active A/N-Inv in chloroplasts uncovers a novel component of the intracellular carbon trafficking.2008 · DOI: 10.1007/s00425-007-0657-1
`At1g56560`	Mitochondrial invertase that cleaves sucrose into glucose and fructose and is involved in the regulation of multiple tissue development and floral transition.	Exploring the neutral invertase-oxidative stress defence connection in Arabidopsis thaliana.2011 · DOI: 10.1093/jxb/err069
`At3g05820`	Chloroplastic invertase that cleaves sucrose into glucose and fructose and may participate in the carbon flux between the cytosol and plastids in leaves.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0529400`	Mitochondrial invertase that cleaves sucrose into glucose and fructose.	No verified direct reference in this release
`Os03g0314800`	Mitochondrial invertase that cleaves sucrose into glucose and fructose.	Genes for alkaline/neutral invertase in rice: alkaline/neutral invertases are located in plant mitochondria and also in plastids.2007 · DOI: 10.1007/s00425-006-0430-x

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022125 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005982 starch metabolic process Biological Process

GO:0005987 sucrose catabolic process Biological Process

GO:0042542 response to hydrogen peroxide Biological Process

GO:0048364 root development Biological Process

GO:0048825 cotyledon development Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004575 sucrose alpha-glucosidase activity Molecular Function

GO:0033926 endo-alpha-N-acetylgalactosaminidase activity Molecular Function

KEGG gene cross-reference

ath:AT1G56560

ath:AT3G05820

ath:AT5G22510

dosa:Os02g0529400

dosa:Os03g0314800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.833

Rank 1 · LXL04_022125 · OH-1004

Mitochondrion0.104

Rank 2 · LXL04_022125 · OH-1004

Cytoplasm0.069

Rank 3 · LXL04_022125 · OH-1004

Nucleus0.054

Rank 4 · LXL04_022125 · OH-1004

Cell membrane0.037

Rank 5 · LXL04_022125 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12899.14Glyco_hydro_100221-663 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022125	`PF12899.14`	Glyco_hydro_100	221	663	1.3e-219	730.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FK88`	Arabidopsis thaliana	Alkaline/neutral invertase E, chloroplastic	68.153%	Swiss-Prot	strong database homology
`Q9FXA8`	Arabidopsis thaliana	Alkaline/neutral invertase A, mitochondrial	73.045%	Swiss-Prot	moderate database homology
`Q84JL5`	Arabidopsis thaliana	Probable alkaline/neutral invertase A, chloroplastic	72.895%	Swiss-Prot	moderate database homology
`Q6H6N5`	Oryza sativa subsp. japonica	Neutral/alkaline invertase 3, chloroplastic	74.865%	Swiss-Prot	strong database homology
`Q10MC0`	Oryza sativa subsp. japonica	Neutral/alkaline invertase 1, mitochondrial	71.633%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card