RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_022093
Reference: OH-1004 Chr: Chr04 Coordinates: 144496906-144498754 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1392 bp · LXL04_022093|LXL04_022093|OH1004|cDNA

ATGGCATTATCGATTGATTCCACACCAGCAGCTTCGTCACTCGCTCCTGGGTTTAGGTTTCATCCAACAGATGAGGAACTCGTACGGTACTATCTCAGGCGCAAGGTTTGCGGTAAACCCTTCCGATTTGACGCGATTTCCGACGTTGATGTCTACAAAGTCGAGCCATGGGATCTTCCAGATTTGTCAAAACTGAAGAGCAGAGACTTAGAATGGTACTTTTTCAGTGCCCTCGACAAGAAATACGGGAACGGATCCAG...

CDS

Download CDS FASTA

1392 bp · LXL04_022093|LXL04_022093|OH1004|CDS

ATGGCATTATCGATTGATTCCACACCAGCAGCTTCGTCACTCGCTCCTGGGTTTAGGTTTCATCCAACAGATGAGGAACTCGTACGGTACTATCTCAGGCGCAAGGTTTGCGGTAAACCCTTCCGATTTGACGCGATTTCCGACGTTGATGTCTACAAAGTCGAGCCATGGGATCTTCCAGATTTGTCAAAACTGAAGAGCAGAGACTTAGAATGGTACTTTTTCAGTGCCCTCGACAAGAAATACGGGAACGGATCCAG...

Protein

Download Protein FASTA

463 aa · LXL04_022093|LXL04_022093|OH1004|PROTEIN

MALSIDSTPAASSLAPGFRFHPTDEELVRYYLRRKVCGKPFRFDAISDVDVYKVEPWDLPDLSKLKSRDLEWYFFSALDKKYGNGSRTNRATEKGYWKTTGKDRAVHHRSQPVGMKKTLVYHSGRAPKGERTNWVMHEYRLIDEELKKAGITQDAFVLCRIFRKSGSGPKNGEKYGAPFIEEEWEDEDESVVVFKQEDFTEELPVDEDSYLDANDIQQILNTDMPVEDIPAESNKSSDPEEPNNVMNFDFDFDYLLDQPY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_022093
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_022093
LocationChr04:144496906-144498754 (+)
DescriptionSimilar to NAC078: NAC domain-containing protein 78
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g04410 Transcriptional activator activated by proteolytic cleavage through regulated intramembrane proteolysis (RIP) (By similarity). No verified direct reference in this release
At3g10500 Transcriptional activator activated by proteolytic cleavage through regulated intramembrane proteolysis (RIP).
A NAC transcription factor NTL4 promotes reactive oxygen species production during drought-induced leaf senescence in Arabidopsis.2012 · DOI: 10.1111/j.1365-313x.2012.04932.x
The Arabidopsis NAC transcription factor NTL4 participates in a positive feedback loop that induces programmed cell death under heat stress conditions.2014 · DOI: 10.1016/j.plantsci.2014.07.003
At3g10480 Transcriptional repressor that binds to the motif 5'- (C/T)A(C/A)G-3' in the promoter of target genes.
Two novel NAC transcription factors regulate gene expression and flowering time by associating with the histone demethylase JMJ14.2015 · DOI: 10.1093/nar/gku1382
C-terminal domains of a histone demethylase interact with a pair of transcription factors and mediate specific chromatin association.2015 · DOI: 10.1038/celldisc.2015.3
At3g10490 Transcriptional repressor that binds to the motif 5'- (C/T)A(C/A)G-3' in the promoter of target genes.
Two novel NAC transcription factors regulate gene expression and flowering time by associating with the histone demethylase JMJ14.2015 · DOI: 10.1093/nar/gku1382
C-terminal domains of a histone demethylase interact with a pair of transcription factors and mediate specific chromatin association.2015 · DOI: 10.1038/celldisc.2015.3
At5g09330 Transcriptional regulator that binds specific DNA sequences on the promoter regions of target genes. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_022093 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process
GO:0006351 DNA-templated transcription Biological Process
GO:0009644 response to high light intensity Biological Process
GO:0009819 drought recovery Biological Process
GO:0009908 flower development Biological Process
GO:0009962 regulation of flavonoid biosynthetic process Biological Process
GO:0010150 leaf senescence Biological Process
GO:0010228 vegetative to reproductive phase transition of meristem Biological Process
GO:0045814 negative regulation of gene expression, epigenetic Biological Process
GO:0045892 negative regulation of DNA-templated transcription Biological Process
GO:0045893 positive regulation of DNA-templated transcription Biological Process
GO:0048573 photoperiodism, flowering Biological Process
KEGG gene cross-reference
ath:AT3G10480
ath:AT3G10500
ath:AT5G04410
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.837
Rank 1 · LXL04_022093 · OH-1004
Cytoplasm0.175
Rank 2 · LXL04_022093 · OH-1004
Endoplasmic reticulum0.105
Rank 3 · LXL04_022093 · OH-1004
Cell membrane0.102
Rank 4 · LXL04_022093 · OH-1004
Plastid0.022
Rank 5 · LXL04_022093 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02365.21NAM16-141 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_022093PF02365.21NAM161411.1e-48165.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q84K00Arabidopsis thalianaNAC domain-containing protein 7875.635%Swiss-Protweak database homology
Q949N0Arabidopsis thalianaNAC domain-containing protein 5373.206%Swiss-Protweak database homology
Q9SQX9Arabidopsis thalianaNAC domain containing protein 5052.788%Swiss-Protmoderate database homology
Q9SQY0Arabidopsis thalianaNAC domain containing protein 5266.120%Swiss-Protweak database homology
Q9FY82Arabidopsis thalianaNAC domain-containing protein 8261.017%Swiss-Protweak database homology

JBrowse

View in Genome Browser