LXL04_022088 | RubberDandelionOmics

Gene overview

LXL04_022088

Reference: OH-1004 Chr: Chr04 Coordinates: 144404138-144405977 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1149 bp · LXL04_022088|LXL04_022088|OH1004|cDNA

ATGGAGATACCTATTAAGCCAATCGATCAACTATTGGAGAGGGTTCTTTGCATGAATATCCTTTCATCAGATTACTTCAAAGAGCTTTATCGTTTCAAAACCTATCACGAAGTGATTGATGAGATATACAATCAAGTCGATCACGTGGAGCCGTGGATGACTGGAAACTGTCGTGGGCCCTCCACTGCATTTTGCCTTCTCTACAAATTCTTCACCATGAAACTTACTGTCAAACAAATGCACGGCCTGTTAAAGCACCC...

CDS

Download CDS FASTA

1149 bp · LXL04_022088|LXL04_022088|OH1004|CDS

ATGGAGATACCTATTAAGCCAATCGATCAACTATTGGAGAGGGTTCTTTGCATGAATATCCTTTCATCAGATTACTTCAAAGAGCTTTATCGTTTCAAAACCTATCACGAAGTGATTGATGAGATATACAATCAAGTCGATCACGTGGAGCCGTGGATGACTGGAAACTGTCGTGGGCCCTCCACTGCATTTTGCCTTCTCTACAAATTCTTCACCATGAAACTTACTGTCAAACAAATGCACGGCCTGTTAAAGCACCC...

Protein

Download Protein FASTA

382 aa · LXL04_022088|LXL04_022088|OH1004|PROTEIN

MEIPIKPIDQLLERVLCMNILSSDYFKELYRFKTYHEVIDEIYNQVDHVEPWMTGNCRGPSTAFCLLYKFFTMKLTVKQMHGLLKHPDSPYIRAVGFLYLRYAADPKTLWGWFEPYIKDDEEFSPGSNGRTTTMGVYVRDLLLGQYYFDTLFPRIPVPVMRAITANLEKLKLPTKHCGVTGESTRGSDDMARRPPSVKAALSVSFGQRAPHRASTRDSSPVRRTLPPLPSYDDSSSRRSPARNRSQSRDLPDRDRDYRDR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022088`
TK1151 ID	TkA05G444180
OH-1004 ID	LXL04_022088
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022088

Location Chr04:144404138-144405977 (-)

Description Similar to SRL1: Pre-mRNA splicing factor SR-like 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g37370`	May be required for pre-mRNA splicing (Probable).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022088 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009651 response to salt stress Biological Process

GO:0010226 response to lithium ion Biological Process

GO:0005634 nucleus Cellular Component

GO:0071011 precatalytic spliceosome Cellular Component

GO:0003723 RNA binding Molecular Function

KEGG gene cross-reference

ath:AT5G37370

hsa:55119

mmu:66921

rno:499691

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.935

Rank 1 · LXL04_022088 · OH-1004

Cytoplasm0.191

Rank 2 · LXL04_022088 · OH-1004

Cell membrane0.023

Rank 3 · LXL04_022088 · OH-1004

Mitochondrion0.012

Rank 4 · LXL04_022088 · OH-1004

Endoplasmic reticulum0.012

Rank 5 · LXL04_022088 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03371.21PRP3811-160 aa

PF12871.13PRP38_assoc181-277 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022088	`PF03371.21`	PRP38	11	160	8.1e-50	169.7
LXL04_022088	`PF12871.13`	PRP38_assoc	181	277	9.6e-07	30.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RWB1`	Arabidopsis thaliana	Pre-mRNA splicing factor SR-like 1	78.764%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card