LXL04_022081 | RubberDandelionOmics

Gene overview

LXL04_022081

Reference: OH-1004 Chr: Chr04 Coordinates: 144358293-144359081 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

789 bp · LXL04_022081|LXL04_022081|OH1004|cDNA

ATGGGGAGATACAGCGACGACGAAGAAGACGAAACATTTTATTACAGATACGCATCTACTACCGCTGCACCACAACCACCTTCATCCTCATCCGATAAAACCCTAACAAAATCCTCATCAAATCGCAAAAGCGGAGGTTTAGCCCCATCAAAATCCACCGTTTACGTTAGCAACATCGATTACAGTCTCACTAATTCCGATCTCTTCACCATCTTCTCTACTTTCGGGAAGGTCGCCAAGGTCACAATCCTCAGAGACAA...

CDS

Download CDS FASTA

789 bp · LXL04_022081|LXL04_022081|OH1004|CDS

ATGGGGAGATACAGCGACGACGAAGAAGACGAAACATTTTATTACAGATACGCATCTACTACCGCTGCACCACAACCACCTTCATCCTCATCCGATAAAACCCTAACAAAATCCTCATCAAATCGCAAAAGCGGAGGTTTAGCCCCATCAAAATCCACCGTTTACGTTAGCAACATCGATTACAGTCTCACTAATTCCGATCTCTTCACCATCTTCTCTACTTTCGGGAAGGTCGCCAAGGTCACAATCCTCAGAGACAA...

Protein

Download Protein FASTA

262 aa · LXL04_022081|LXL04_022081|OH1004|PROTEIN

MGRYSDDEEDETFYYRYASTTAAPQPPSSSSDKTLTKSSSNRKSGGLAPSKSTVYVSNIDYSLTNSDLFTIFSTFGKVAKVTILRDKVTRESRGVAFILFVARDDAVKAVNGINGKVLNSRTLTASIAADNGRAPEFIRRKVYKDKSRCYECGEGGHLSYECPKNQFGPRERPQPSKRGRRDGSSGGGGGGGYRRSKEEEGGGDDDEIGGDEVFEDDNWASVVDNEADERLLGGSDGNQGKKGKKDKRKKTSYFSDESDK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022081`
TK1151 ID	TkA05G444020
OH-1004 ID	LXL04_022081
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.600
Protein coverage (%)	TK1151 84.351 / OH-1004 84.351 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022081

Location Chr04:144358293-144359081 (-)

Description Similar to SNRNP31: U11/U12 small nuclear ribonucleoprotein 31 kDa protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g10400`	RNA chaperone required for proper U12 intron splicing and for normal growth and development of plants.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022081 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0008380 RNA splicing Biological Process

GO:0032502 developmental process Biological Process

GO:0051302 regulation of cell division Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005689 U12-type spliceosomal complex Cellular Component

GO:0005829 cytosol Cellular Component

GO:0034693 U11/U12 snRNP Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT3G10400

hsa:85437

mmu:67197

rno:362990

xla:446310

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.961

Rank 1 · LXL04_022081 · OH-1004

Cytoplasm0.120

Rank 2 · LXL04_022081 · OH-1004

Cell membrane0.019

Rank 3 · LXL04_022081 · OH-1004

Endoplasmic reticulum0.012

Rank 4 · LXL04_022081 · OH-1004

Mitochondrion0.008

Rank 5 · LXL04_022081 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076.29RRM_154-123 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022081	`PF00076.29`	RRM_1	54	123	2.4e-17	63.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9CAE4`	Arabidopsis thaliana	U11/U12 small nuclear ribonucleoprotein 31 kDa protein	55.133%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card