LXL04_022043 | RubberDandelionOmics

Gene overview

LXL04_022043

Reference: OH-1004 Chr: Chr04 Coordinates: 143890933-143894608 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2235 bp · LXL04_022043|LXL04_022043|OH1004|cDNA

ATGGAAAATCAAACAATAGAAAATGTGTTGAAATCTGATGGAAGAAGAATGGAGGGATGGTTGTATCTCATTCGATGCAACCGCTTTGGGTTACAATACTCTCGCAGAAGGTATTTTATTCTCGAAGAAAATTACCTCAAGAGCTTCAAATCTAAACCTACATCAGATTCACAGaaaCCACTAAGAAGTGCGATCGTAGATTCTTTCATACGAGTCAATGATAATGGAAGAGAAAGCTTCAGTAGAAAAGTGTTTTTCAT...

CDS

Download CDS FASTA

2235 bp · LXL04_022043|LXL04_022043|OH1004|CDS

ATGGAAAATCAAACAATAGAAAATGTGTTGAAATCTGATGGAAGAAGAATGGAGGGATGGTTGTATCTCATTCGATGCAACCGCTTTGGGTTACAATACTCTCGCAGAAGGTATTTTATTCTCGAAGAAAATTACCTCAAGAGCTTCAAATCTAAACCTACATCAGATTCACAGAAACCACTAAGAAGTGCGATCGTAGATTCTTTCATACGAGTCAATGATAATGGAAGAGAAAGCTTCAGTAGAAAAGTGTTTTTCAT...

Protein

Download Protein FASTA

744 aa · LXL04_022043|LXL04_022043|OH1004|PROTEIN

MENQTIENVLKSDGRRMEGWLYLIRCNRFGLQYSRRRYFILEENYLKSFKSKPTSDSQKPLRSAIVDSFIRVNDNGRESFSRKVFFIFTLYNTSNHNDCLKVRKNILHIYRVVIEILKIIILQLGASSPEDAARWIHSLQDVAMEPGTNSKRRWQPFRLNDSKNTTRKNSVDWSSSANMHVDAMTSDVIAPSQWKIFGCKNGLRLFKEARDTSNNTTERASNDYPAIMAVGVIEGTSESVFRTFMSLGQSRSEWDFCFYQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022043`
TK1151 ID	TkA05G442620
OH-1004 ID	LXL04_022043
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 53.091 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022043

Location Chr04:143890933-143894608 (-)

Description Similar to EDR2L: Protein ENHANCED DISEASE RESISTANCE 2-like

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g45560`	Binds to phosphatidylinositol-4-phosphate (PtdIns(4)P).	No verified direct reference in this release
`At4g19040`	May negatively regulate salicylic acid-mediated disease resistance.	Regulation of plant defense responses in Arabidopsis by EDR2, a PH and START domain-containing protein.2005 · DOI: 10.1111/j.1365-313x.2005.02523.x EDR2 negatively regulates salicylic acid-based defenses and cell death during powdery mildew infections of Arabidopsis thaliana.2007 · DOI: 10.1186/1471-2229-7-35

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022043 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009751 response to salicylic acid Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:1900056 negative regulation of leaf senescence Biological Process

GO:1900150 regulation of defense response to fungus Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0010008 endosome membrane Cellular Component

GO:0008289 lipid binding Molecular Function

KEGG gene cross-reference

ath:AT4G19040

ath:AT5G45560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.314

Rank 1 · LXL04_022043 · OH-1004

Nucleus0.283

Rank 2 · LXL04_022043 · OH-1004

Cell membrane0.240

Rank 3 · LXL04_022043 · OH-1004

Endoplasmic reticulum0.154

Rank 4 · LXL04_022043 · OH-1004

Golgi apparatus0.154

Rank 5 · LXL04_022043 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01852.26START208-358 aa

PF07059.18EDR2_C519-726 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022043	`PF01852.26`	START	208	358	6.5e-19	68.8
LXL04_022043	`PF07059.18`	EDR2_C	519	726	1.3e-76	257.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VZF6`	Arabidopsis thaliana	Protein ENHANCED DISEASE RESISTANCE 2-like	33.289%	Swiss-Prot	moderate database homology
`F4JSE7`	Arabidopsis thaliana	Protein ENHANCED DISEASE RESISTANCE 2	31.341%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card