Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1845 bp · LXL04_021990|LXL04_021990|OH1004|cDNA
ATGGCACCGATTGATCCACACTCGTTCACTGATGCAACCCACCCTCTAACATCCCACATCTCCCTTTCGTTCTACTTCGATTTCTCCACCTCCACCATCTTCTCCTCCGCCTTGCTCACTCTCTGCGCTCCGCATACCGGCGATCTACTCCTCGACACTCGTTCACTCACAATAAAATCGGTAATCGACCCAATTAATAACACCAAACTCCCATTTTCCCTTTCTTCCGACGTTGACCCCATAAAGGGCCAACATTTAAC...
1845 bp · LXL04_021990|LXL04_021990|OH1004|CDS
ATGGCACCGATTGATCCACACTCGTTCACTGATGCAACCCACCCTCTAACATCCCACATCTCCCTTTCGTTCTACTTCGATTTCTCCACCTCCACCATCTTCTCCTCCGCCTTGCTCACTCTCTGCGCTCCGCATACCGGCGATCTACTCCTCGACACTCGTTCACTCACAATAAAATCGGTAATCGACCCAATTAATAACACCAAACTCCCATTTTCCCTTTCTTCCGACGTTGACCCCATAAAGGGCCAACATTTAAC...
Protein
Download Protein FASTA614 aa · LXL04_021990|LXL04_021990|OH1004|PROTEIN
MAPIDPHSFTDATHPLTSHISLSFYFDFSTSTIFSSALLTLCAPHTGDLLLDTRSLTIKSVIDPINNTKLPFSLSSDVDPIKGQHLTVSLTNHSKILITFVTSPSSSALQWLTPPQTFNKKFPFVYTQCQSIHARSIFPCQDTPASRVRYNAKLNIPHQLSAVMSARHVERRAPLAGSDSGFACDESLWCAEGRVVEEFTMEQPIPPYLFAFAVGEIAYREVGPRTKVFAEAVPAVLDAAAKEFAGTEDMIRVGEKLFGD...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_021990 |
|---|---|
| TK1151 ID | TkA05G437900 |
| OH-1004 ID | LXL04_021990 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 59.400 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 73.453Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_021990 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr04:142088615-142090618 (-) | ||||||||||||
| Description | Similar to LKHA4: Leucine aminopeptidase | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0006508 proteolysis Biological Process GO:0006629 lipid metabolic process Biological Process GO:0010043 response to zinc ion Biological Process GO:0019370 leukotriene biosynthetic process Biological Process GO:0030163 protein catabolic process Biological Process GO:0043171 peptide catabolic process Biological Process GO:0043434 response to peptide hormone Biological Process GO:0120113 cytoplasm to vacuole targeting by the NVT pathway Biological Process GO:0005576 extracellular region Cellular Component GO:0005634 nucleus Cellular Component GO:0005771 multivesicular body Cellular Component GO:0005829 cytosol Cellular Component | ||||||||||||
| KEGG gene cross-reference | ath:AT5G13520 bfu:BCIN_09g05630 bta:507130 dosa:Os03g0819100 hsa:4048 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF17900.7Peptidase_M1_N28-173 aaPF01433.27Peptidase_M1253-440 aaPF09127.18Leuk-A4-hydro_C495-610 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_021990 | PF17900.7 | Peptidase_M1_N | 28 | 173 | 4.1e-13 | 50.6 |
| LXL04_021990 | PF01433.27 | Peptidase_M1 | 253 | 440 | 1.1e-41 | 143.6 |
| LXL04_021990 | PF09127.18 | Leuk-A4-hydro_C | 495 | 610 | 2.2e-28 | 99.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.