LXL04_021862 | RubberDandelionOmics

Gene overview

LXL04_021862

Reference: OH-1004 Chr: Chr04 Coordinates: 138775567-138780402 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1722 bp · LXL04_021862|LXL04_021862|OH1004|cDNA

ATGTTGCATTCTAGCCGTTACCTTCTTCGCATCCGGAGACAAAAGGGAAAGAAGGACACAACTCACCTCTGGCTCACGGTTGTTTTCCCGGAGAAAATTCACCGGCTGACAAACATGGCGGTGCGTCGATCAATTTGGCCTTCGAAATTAAAGCTTGCATTTGCTGCCACCGCCTTGGGCTGCGGAGTTGGTGCCGCGACCATTGCTAATTCCGACGATCCTGCCACCTCCTTCAAGCTCTGCACCGCTATCCCTCTCCG...

CDS

Download CDS FASTA

1722 bp · LXL04_021862|LXL04_021862|OH1004|CDS

ATGTTGCATTCTAGCCGTTACCTTCTTCGCATCCGGAGACAAAAGGGAAAGAAGGACACAACTCACCTCTGGCTCACGGTTGTTTTCCCGGAGAAAATTCACCGGCTGACAAACATGGCGGTGCGTCGATCAATTTGGCCTTCGAAATTAAAGCTTGCATTTGCTGCCACCGCCTTGGGCTGCGGAGTTGGTGCCGCGACCATTGCTAATTCCGACGATCCTGCCACCTCCTTCAAGCTCTGCACCGCTATCCCTCTCCG...

Protein

Download Protein FASTA

573 aa · LXL04_021862|LXL04_021862|OH1004|PROTEIN

MLHSSRYLLRIRRQKGKKDTTHLWLTVVFPEKIHRLTNMAVRRSIWPSKLKLAFAATALGCGVGAATIANSDDPATSFKLCTAIPLRLFRLSVTAATIAFDYEYSLMGLPEGSDERAKVKHELHTRNARRLEELCFKNGGIYIKLGQHVGQLEYLVPPEYTKTMRESMLNKCPTSTYDQVCKVVKKELGGTPEEIFDEFDPVPIASASLAQVHVARTHEGQKVAVKVQHTHMTDTAAADFATVEMIVNTVHRFFPSFDYR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021862`
TK1151 ID	TkA05G430400
OH-1004 ID	LXL04_021862
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 93.368 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021862

Location Chr04:138775567-138780402 (-)

Description Similar to At2g40090: Putative ABC1 protein At2g40090

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g40090`	Putative ABC1 protein At2g40090.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021862 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007005 mitochondrion organization Biological Process

GO:0010637 negative regulation of mitochondrial fusion Biological Process

GO:0055088 lipid homeostasis Biological Process

GO:1903852 positive regulation of cristae formation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT2G40090

gga:423382

hsa:57143

mmu:72113

xtr:496824

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.811

Rank 1 · LXL04_021862 · OH-1004

Plastid0.099

Rank 2 · LXL04_021862 · OH-1004

Cytoplasm0.064

Rank 3 · LXL04_021862 · OH-1004

Endoplasmic reticulum0.048

Rank 4 · LXL04_021862 · OH-1004

Cell membrane0.037

Rank 5 · LXL04_021862 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03109.23ABC1168-425 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021862	`PF03109.23`	ABC1	168	425	3.2e-81	272.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04212`	Arabidopsis thaliana	Putative ABC1 protein At2g40090	70.280%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card